ID: 1187267948

View in Genome Browser
Species Human (GRCh38)
Location X:17754056-17754078
Sequence CTTCATCCAAACCACCCTTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187267948_1187267949 29 Left 1187267948 X:17754056-17754078 CCGCAAGGGTGGTTTGGATGAAG 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1187267949 X:17754108-17754130 ATATTAAAACTGTCATATTTTGG 0: 1
1: 0
2: 8
3: 53
4: 591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187267948 Original CRISPR CTTCATCCAAACCACCCTTG CGG (reversed) Exonic
901247430 1:7743788-7743810 CTTAATCCAGACCAGCTTTGAGG + Intronic
903027841 1:20442339-20442361 CTGGATTCAAACCACCCTTGTGG + Intergenic
903273783 1:22208286-22208308 CTTCAGCCAAACACCCCCTGGGG - Intergenic
905273217 1:36800599-36800621 CTTCTTCCTCCCCACCCTTGGGG + Exonic
905420701 1:37841506-37841528 CTTCACCAAAGCCACCCTTTAGG + Intronic
905645125 1:39619917-39619939 AGGCATCCAACCCACCCTTGTGG + Intergenic
906853514 1:49279800-49279822 CTTAAGCCAAACTAACCTTGGGG + Intronic
907276390 1:53319244-53319266 CTTCATCCCAGCCACTCTGGAGG - Intronic
909056483 1:70826731-70826753 CTACATACAAAACTCCCTTGTGG + Intergenic
912821998 1:112875151-112875173 CTAAATCCAATCAACCCTTGAGG - Intergenic
913495525 1:119424847-119424869 CATCATCCTAACCACCTTGGAGG + Intergenic
915930693 1:160059062-160059084 CTTCATCCTAGCCTCCCTAGGGG + Intronic
916485123 1:165251720-165251742 CTGAACCCAAACCACCCTTCAGG + Intronic
917809263 1:178641856-178641878 CTTCATTCAACCCAAACTTGGGG - Intergenic
918806161 1:189048277-189048299 CTTCATCCAACCCACTATTGAGG + Intergenic
921300994 1:213751445-213751467 TTTCAGCCAAACCACGCTTTTGG + Intergenic
921952244 1:220942498-220942520 CTTTATCCAATCTACCGTTGAGG + Intergenic
922309299 1:224373331-224373353 CTTCATCCTCCCCACCCCTGCGG + Intronic
922543757 1:226438739-226438761 CTTCAAACACACAACCCTTGAGG - Intergenic
922747180 1:228050935-228050957 CTTTTTCCCAAGCACCCTTGCGG - Intronic
924810884 1:247400921-247400943 CTCCCTCCAGACCACCCTCGGGG - Intergenic
1064293155 10:14053716-14053738 CTCCATCAAAAAGACCCTTGTGG + Intronic
1065631815 10:27687900-27687922 CTCCCTCCAGACCACCCTCGTGG - Intronic
1067558232 10:47286984-47287006 CTTCCCCCAAACCACACATGAGG - Intergenic
1067947612 10:50700085-50700107 CTTCAGCAAAACCACACGTGGGG - Intergenic
1069678387 10:70266092-70266114 CTGCATGCCCACCACCCTTGTGG - Exonic
1070882931 10:79865072-79865094 CTTCAGCAAAACCACACGTGGGG - Intergenic
1071649498 10:87381376-87381398 CTTCAGCAAAACCACACGTGGGG - Intergenic
1073298759 10:102457817-102457839 CTTCATCAAAACCACCATCTTGG - Intergenic
1074100187 10:110348612-110348634 CTTCTTCCAACCCAACCATGAGG - Intergenic
1076078803 10:127559246-127559268 CTTCATCAATACCACCATGGGGG + Intergenic
1076492093 10:130868624-130868646 CTTCATCAAAACAACCATGGTGG - Intergenic
1081596392 11:44462400-44462422 CTTCTTCTAGACCACACTTGGGG + Intergenic
1088452210 11:109994282-109994304 TTTTATCCATACCACCCTTAAGG - Intergenic
1089528145 11:119110106-119110128 CTCCATCCAAATCGCCTTTGAGG + Exonic
1090096649 11:123748603-123748625 CTTTATCCAGTCCACCATTGAGG + Intergenic
1092481231 12:8860874-8860896 CATCATCAACACCACCCTAGAGG - Exonic
1093388555 12:18588849-18588871 CTTCATCCAACCTGCCATTGAGG - Intronic
1094483577 12:30905457-30905479 CTTCTTTCAAACTTCCCTTGGGG - Intergenic
1098426189 12:70367101-70367123 CTGCCTCCAAACCTCCCTCGCGG - Intronic
1099419342 12:82435710-82435732 CTTCATCCTAACAACCCTATAGG - Intronic
1104732871 12:131118107-131118129 CTTCATCAAAACAAACCATGTGG - Intronic
1107242440 13:38252615-38252637 CATCATCCTAACCATCCTGGTGG - Intergenic
1112441998 13:99431383-99431405 ATTCATCAAAACTAACCTTGAGG + Intergenic
1116190652 14:41661420-41661442 TTACATTCAAATCACCCTTGAGG - Intronic
1116672318 14:47859155-47859177 CTTTATCCAATCCACCATTGAGG + Intergenic
1119698164 14:76730640-76730662 CTGCATCCATGCCACACTTGGGG - Intergenic
1122303300 14:100744416-100744438 CTTCATCCAACCCACCTATTTGG + Intergenic
1124690198 15:31815417-31815439 CATCACCCCAGCCACCCTTGAGG - Intronic
1125093678 15:35826400-35826422 CTTTATCCAACCCACTGTTGAGG - Intergenic
1126540635 15:49818868-49818890 CTTTATCCAATCTACCATTGAGG - Intergenic
1128233982 15:66054544-66054566 CTTCATCCAGACACCCCTGGAGG - Intronic
1130726252 15:86442588-86442610 CTTCATTCAATCCACCATTGTGG + Intronic
1134895859 16:17886281-17886303 CTACATCCTACCCACCCCTGGGG + Intergenic
1136404854 16:30038792-30038814 ATTTATCCAAAGCAACCTTGTGG + Intronic
1137634624 16:49975054-49975076 CTTCCTCCACATCAGCCTTGAGG - Intergenic
1137965559 16:52929179-52929201 CGTCATCGAAACAAGCCTTGGGG + Intergenic
1138483247 16:57318199-57318221 CTTTCTCCATACCACCCTTCAGG - Intergenic
1139094961 16:63694373-63694395 CTTTATACAATCCACCATTGTGG - Intergenic
1139229457 16:65269452-65269474 CTTTATCCAATCGACCATTGTGG + Intergenic
1140609914 16:76585752-76585774 CCTCAGCCAAACAACCCTTGAGG - Intronic
1143301728 17:5915566-5915588 CTGCAGCCAAAGCACCCGTGTGG - Intronic
1143704376 17:8687069-8687091 CTTCATCCTGACCACCCCTCAGG + Intergenic
1147534136 17:41307744-41307766 CATCAGCCCAACCACCCGTGAGG - Exonic
1148793218 17:50185116-50185138 CTTTCTCCACACCCCCCTTGGGG - Exonic
1149021232 17:51967446-51967468 CTTTATCCAGTCCACCATTGAGG - Intronic
1149880164 17:60281806-60281828 CTACATCAAAATCACCCTGGAGG + Intronic
1150145232 17:62763298-62763320 CTCCATTCATACCACCCTTTTGG - Intronic
1150324255 17:64243421-64243443 CTTCTTCAAAAAGACCCTTGGGG + Intronic
1150601448 17:66654379-66654401 TTTCATCCCAACCACCTTTTGGG + Intronic
1150715712 17:67571040-67571062 CTTCTTCCAAATCACCCATCTGG - Intronic
1153723761 18:7935598-7935620 CTTCCTCCATAGCAACCTTGAGG + Intronic
1157729071 18:49988292-49988314 CCTCAGCCAATCCACCCATGAGG + Intronic
1159943926 18:74429550-74429572 CTACATCAAAGCCAACCTTGTGG + Intergenic
1160603361 18:80031404-80031426 CATCATCCCAACCACCCTGGAGG - Intronic
1161582579 19:5088766-5088788 CTTCATCCGCACATCCCTTGGGG + Intronic
1162675182 19:12293712-12293734 CTTCATCCTAACTCCTCTTGGGG - Intronic
1163132623 19:15285077-15285099 CTGCATCCAAGGCTCCCTTGTGG - Intronic
1163797432 19:19345670-19345692 CTTGAGCCAATCCAGCCTTGGGG - Intronic
1164540039 19:29115368-29115390 CTTCATCCAGCCCAATCTTGTGG - Intergenic
1165548736 19:36564852-36564874 CTTTATCCAAGCCACTGTTGAGG - Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
925268694 2:2586340-2586362 CTTGATCCACACCCCCCTTCCGG - Intergenic
926198358 2:10776852-10776874 CTTCGCCCACACCACCCTGGGGG + Intronic
929097885 2:38281115-38281137 CTTCATAAAAAGCACCTTTGGGG - Intergenic
940720107 2:157272761-157272783 CTTTATCCAATCCACCATTGAGG + Intronic
943531760 2:189091101-189091123 CTTCTTCCAAACTTCTCTTGAGG - Intronic
944992488 2:205253912-205253934 CTTCTTTCAAACCACCTCTGTGG - Intronic
947672085 2:231944160-231944182 CTGGCTACAAACCACCCTTGGGG - Intergenic
1172019721 20:31905452-31905474 CCTTCTCCAAACCTCCCTTGTGG - Intronic
1176180655 20:63747897-63747919 CTTCCTCCAAACCTCCCTGCAGG + Intronic
1178034669 21:28566516-28566538 CTTTATCCAACCCACTGTTGAGG - Intergenic
1182327474 22:29524671-29524693 TTTCATCCAGAGCACCCCTGGGG + Intronic
1182983584 22:34695890-34695912 CTTCAGCCAAACAACCATTTGGG + Intergenic
1183368774 22:37420589-37420611 CTTCATCCCGACCACACTTTAGG + Intronic
950172072 3:10845584-10845606 CTTCATCCTACCCACCATTGTGG - Intronic
950341588 3:12250885-12250907 CTTTATCCAATCCACGGTTGAGG - Intergenic
953612930 3:44462636-44462658 CTTTCTCTAAACCACCCTGGGGG + Intronic
953808348 3:46090984-46091006 CTTGCTCCAGCCCACCCTTGGGG + Intergenic
961666439 3:128495943-128495965 CTTCATCCACCCCACCCTGAGGG - Intergenic
970169011 4:13270215-13270237 CTTTATCCAATCCACCATTTTGG + Intergenic
971478146 4:27091163-27091185 CTTCATGCACTCCACCCCTGAGG - Intergenic
973177569 4:47226639-47226661 CTTCATCCAAGTATCCCTTGAGG + Intronic
975971189 4:80039873-80039895 CTTCATCCAGTCCACTGTTGAGG - Intronic
976390950 4:84502962-84502984 CTTGAACCAACCTACCCTTGAGG + Intergenic
977527117 4:98158892-98158914 CTTTCTCTAAACTACCCTTGGGG + Intergenic
978398665 4:108309016-108309038 TTTCATCCAAGGCACCCTTTGGG + Intergenic
978716293 4:111846961-111846983 ATTCATCCAAACCAACCAGGTGG - Intergenic
980321810 4:131289570-131289592 CTTTCTCTAAACTACCCTTGGGG - Intergenic
981400069 4:144303445-144303467 CTTCATCCCCACCACACCTGTGG + Intergenic
986033381 5:3914484-3914506 CTGCATCCAAAACGTCCTTGTGG - Intergenic
986777996 5:11036719-11036741 CTACATCTAAACCATCTTTGCGG + Intronic
987103902 5:14617913-14617935 CTTCAGCCACACCATACTTGAGG - Intergenic
988207821 5:28163094-28163116 CTTTGTCCAAACCACCATTGTGG - Intergenic
989463511 5:41727819-41727841 AATCATCCAAACACCCCTTGTGG - Intergenic
992214617 5:74514060-74514082 CTTGCTTCAAACCAGCCTTGTGG + Intergenic
993578323 5:89629109-89629131 CTTTATCCAACCCACAATTGAGG + Intergenic
996199137 5:120649127-120649149 CTTCTTCCAATCCACCCCAGTGG - Intronic
996327663 5:122293877-122293899 CTTTATCCAATCCACCATTGAGG + Intergenic
997208546 5:132064581-132064603 CTTGATCCATCCCTCCCTTGAGG + Intergenic
997380439 5:133432466-133432488 CTTCTGCCAAACCTACCTTGTGG + Intronic
999191044 5:149747780-149747802 CTGCATCCACACCTCCCTGGTGG + Intronic
1001430234 5:171655092-171655114 CTTTCTCCACACCAGCCTTGTGG - Intergenic
1001817252 5:174680312-174680334 CTTCCTCCCAACCACGCTTCTGG + Intergenic
1002460010 5:179368658-179368680 CTATCTCCAAGCCACCCTTGTGG + Intergenic
1004405971 6:15333954-15333976 GTTCATCCAAACCAGTCTCGGGG - Intronic
1007453864 6:41961171-41961193 CTTCATCAAAACAATCCTTGTGG + Intronic
1007817136 6:44532523-44532545 CTTGATAGAAACCACCCTTCAGG + Intergenic
1009522044 6:64695130-64695152 CCCCATCCAACCCACCCTAGAGG + Intronic
1010399815 6:75435638-75435660 ATTCATCCCTCCCACCCTTGGGG - Intronic
1012746066 6:103091171-103091193 CTTCATCCAGTCTACCATTGAGG - Intergenic
1013186495 6:107764011-107764033 CTTCATACAAAACTCCCTTGGGG + Intronic
1013933490 6:115564909-115564931 CTTTATCCAATCCACCATTGTGG - Intergenic
1016983038 6:149870366-149870388 CTTAATCCTCACCACACTTGTGG - Intergenic
1019346046 7:531359-531381 CTTCACCCACACTGCCCTTGGGG + Intergenic
1023382081 7:39618850-39618872 CTTCATGCCGACGACCCTTGTGG - Intergenic
1023592928 7:41797970-41797992 CTTCATGCAAACCATCTGTGGGG - Intergenic
1027949409 7:84795138-84795160 CTTCATCCAATACACCACTGAGG + Intergenic
1029913667 7:104183264-104183286 CTCCCTTCAAACCTCCCTTGTGG + Intronic
1031544353 7:123033534-123033556 CTTCATCCAGTCCACCATTGAGG - Intergenic
1031912262 7:127530616-127530638 CTTTATCCAATCCACCACTGAGG - Intergenic
1035103701 7:156423010-156423032 CTTTATCCAATCCACCATTTAGG + Intergenic
1040035444 8:42865616-42865638 CTTCATCCAGCCAACCCTTCAGG + Intronic
1042799678 8:72705221-72705243 CTTCAGCCAAATCACCCTACTGG - Intronic
1046479156 8:114792088-114792110 CTTCATCTTAGCCACCTTTGTGG - Intergenic
1046507079 8:115150134-115150156 CTTTAACCAAAACAGCCTTGAGG + Intergenic
1048106325 8:131414287-131414309 CATCATCCAAAACATACTTGAGG + Intergenic
1048165197 8:132056060-132056082 CTTGATCCATACCACCCTAGTGG + Intronic
1052351998 9:27467563-27467585 CCTCATCCAAACCACGAGTGGGG - Intronic
1054880914 9:70143761-70143783 TTGCATCCAAACACCCCTTGGGG - Exonic
1058031321 9:100201168-100201190 CTGCCTCCATACCACCCTTATGG - Intronic
1060494083 9:124105272-124105294 CTTCATCCCCACCACTCCTGTGG + Intergenic
1185768182 X:2743334-2743356 CCTCATCCTCTCCACCCTTGAGG - Intergenic
1187267948 X:17754056-17754078 CTTCATCCAAACCACCCTTGCGG - Exonic
1188398993 X:29721118-29721140 TTTCAGCCGAACCACCCTAGGGG + Intronic
1188702190 X:33278566-33278588 CTTCAGCCAATCAACCATTGTGG + Intronic
1190413165 X:50156657-50156679 CTTCCTCCAAACACCCCTTCTGG + Intergenic
1192389300 X:70708555-70708577 CTTTATCCAATCCACCATTGAGG - Intronic
1193294629 X:79820235-79820257 CATCATCCTAATCACCCTGGGGG + Intergenic
1194447421 X:94005881-94005903 CTTTCTCTAAACTACCCTTGGGG - Intergenic
1195018118 X:100798383-100798405 CATCATCCTAACTACCCTAGAGG - Intergenic
1195854374 X:109314320-109314342 TCTCATCCAAAACACCCTTATGG + Intergenic
1199170042 X:144725255-144725277 CTGCCTCCAAACCACCATTTTGG - Intergenic
1201593498 Y:15640341-15640363 CTTTATCCAACACACCATTGAGG + Intergenic