ID: 1187269765

View in Genome Browser
Species Human (GRCh38)
Location X:17769128-17769150
Sequence AAGATTCAACAGATGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187269765_1187269770 10 Left 1187269765 X:17769128-17769150 CCTCCCTGCATCTGTTGAATCTT 0: 1
1: 0
2: 2
3: 17
4: 219
Right 1187269770 X:17769161-17769183 ATTGCAATGCATGGTACACCCGG 0: 1
1: 0
2: 1
3: 8
4: 53
1187269765_1187269771 15 Left 1187269765 X:17769128-17769150 CCTCCCTGCATCTGTTGAATCTT 0: 1
1: 0
2: 2
3: 17
4: 219
Right 1187269771 X:17769166-17769188 AATGCATGGTACACCCGGTCAGG 0: 1
1: 0
2: 0
3: 1
4: 31
1187269765_1187269772 24 Left 1187269765 X:17769128-17769150 CCTCCCTGCATCTGTTGAATCTT 0: 1
1: 0
2: 2
3: 17
4: 219
Right 1187269772 X:17769175-17769197 TACACCCGGTCAGGCAGTCCTGG 0: 1
1: 0
2: 2
3: 5
4: 47
1187269765_1187269769 1 Left 1187269765 X:17769128-17769150 CCTCCCTGCATCTGTTGAATCTT 0: 1
1: 0
2: 2
3: 17
4: 219
Right 1187269769 X:17769152-17769174 GGCTTTGTCATTGCAATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187269765 Original CRISPR AAGATTCAACAGATGCAGGG AGG (reversed) Intergenic
901127525 1:6940070-6940092 AAGATTTCACAGGTGCAGGGTGG - Intronic
902603924 1:17558309-17558331 GAGATTCAAGAGATGATGGGTGG - Intronic
903804939 1:25998555-25998577 AGGTGTCAACAGATGCAGGCTGG - Intergenic
904487337 1:30835497-30835519 AAGATACAATAGAGGCAGTGAGG - Intergenic
904614785 1:31743852-31743874 AAGAATCAGCAAATGCAGGGAGG + Intronic
904917092 1:33977901-33977923 AAGAGTCAACAGAAGCGGGCAGG + Intronic
907866294 1:58402497-58402519 AAGAAACAAGAGATGGAGGGAGG + Intronic
909012338 1:70348564-70348586 AAGATTAAAAAGGTGCAGGCTGG - Intronic
909163072 1:72179444-72179466 AATAATTAACTGATGCAGGGTGG + Intronic
909278651 1:73721182-73721204 AGGACTTAAAAGATGCAGGGTGG + Intergenic
910176405 1:84435520-84435542 CAGATTCAAGAGAAGCTGGGAGG + Intergenic
910331780 1:86081415-86081437 AAGATTCTACATATGCAGCCAGG - Intronic
910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG + Intergenic
910757578 1:90708531-90708553 AAAATTAAACGGATACAGGGTGG + Intergenic
913665685 1:121046593-121046615 GAGATTCAACAGATGAACTGAGG + Intergenic
914017082 1:143829868-143829890 GAGATTCAACAGATGAACTGAGG + Intergenic
914160704 1:145131130-145131152 GAGATTCAACAGATGAACTGAGG - Intergenic
914655694 1:149738410-149738432 GAGATTCAACAGATGAACTGAGG + Intergenic
914902293 1:151717120-151717142 AAGACTCAGCAGATGGGGGGTGG + Intronic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
917785585 1:178453115-178453137 AAAATGCAAAAGATGGAGGGGGG + Intronic
917851489 1:179068584-179068606 AAAATTAACCAGATGCAGTGAGG - Intronic
918694316 1:187524320-187524342 AAAATAAAACAGAAGCAGGGTGG - Intergenic
918694566 1:187528516-187528538 AAGCTTAAAAAGATGCAGGCAGG + Intergenic
919782191 1:201228318-201228340 ACCACTGAACAGATGCAGGGTGG + Intronic
921828999 1:219706218-219706240 AAGAAACAACAGATGCCGTGAGG + Intronic
921843527 1:219854555-219854577 AAGAAACAACAGATGCTGGAGGG - Intronic
924270854 1:242331082-242331104 AATATTGAACAAATGCAGTGTGG - Intronic
1065858821 10:29853191-29853213 AACTCTCAACAGATGCAGGCTGG + Intergenic
1066042428 10:31563436-31563458 AGGAAACAACAGATGCTGGGAGG - Intergenic
1067665711 10:48276498-48276520 CAGGTTCAGCAGATTCAGGGTGG - Intergenic
1067986867 10:51158571-51158593 AATATTCAAAGGATGCAGAGAGG - Intronic
1068192253 10:53667278-53667300 AAGATTCTCCAGATGCCTGGAGG - Intergenic
1070048628 10:72864669-72864691 AGGTTTCAAAAGTTGCAGGGGGG + Intronic
1072733071 10:97861091-97861113 CGGATTCAGCAGATCCAGGGAGG - Intronic
1074260882 10:111852094-111852116 AAGCTCTAACAGAGGCAGGGCGG + Intergenic
1074548667 10:114422984-114423006 AAAATACAAAAGATGCATGGTGG - Intergenic
1076475229 10:130746957-130746979 GAGATTCAACGGATGCAGGAAGG + Intergenic
1080423637 11:32136402-32136424 AATATTCCACAGATGGATGGTGG + Intergenic
1083054223 11:59804268-59804290 AAGAGGAAACAGATGTAGGGTGG - Intergenic
1083346999 11:62000855-62000877 AAGTCTCAACAGAGGCAGAGTGG - Intergenic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1085402424 11:76242807-76242829 AATATTCCACAGCTGCAGGGAGG - Intergenic
1086356253 11:86003365-86003387 AAGATTCTACAGCTGCAAGCAGG - Exonic
1087692232 11:101334715-101334737 AAGATACAACAGAGGGAGGTAGG - Intergenic
1093229958 12:16531865-16531887 AAGTATTAACAGGTGCAGGGGGG + Intronic
1094050127 12:26210664-26210686 CTGTCTCAACAGATGCAGGGGGG - Intronic
1094497850 12:31000183-31000205 AATATTCCACAGAAGCAAGGGGG - Intergenic
1095500530 12:42833204-42833226 AAGATTCAACATATGAATGTTGG + Intergenic
1095571602 12:43689181-43689203 AAGAGTAAACACATTCAGGGTGG - Intergenic
1096973925 12:55687784-55687806 AAGATAAATCAGATGCAGGCTGG - Intronic
1097317357 12:58186273-58186295 AAGATTTCACATATGCAGAGAGG - Intergenic
1097675719 12:62601113-62601135 AAGATTCCTGATATGCAGGGAGG + Intergenic
1097713867 12:62944443-62944465 GAGATTCAGCAGATGCAGAAAGG - Intergenic
1097737301 12:63196360-63196382 AAGAGTGAACCGAAGCAGGGTGG + Intergenic
1099011832 12:77300719-77300741 AACATGCAACACATACAGGGAGG + Intergenic
1099177992 12:79444084-79444106 AAGATTCATCTGATGCAGAATGG + Exonic
1100094682 12:91018575-91018597 AAGATGTAACATATGCAGAGTGG + Intergenic
1100541836 12:95564653-95564675 AAGGTTCAACAGATGCATTTAGG + Intergenic
1101280123 12:103244969-103244991 AAGAGTCAACAGAAGCAAAGGGG + Intronic
1103173050 12:118838395-118838417 AGGATAGAACAGATGCAGGGAGG - Intergenic
1104355036 12:128077797-128077819 CAGATTCAGCAGAACCAGGGAGG + Intergenic
1106264366 13:28096885-28096907 AAGATTAAAGAGATGGAGGTAGG - Intronic
1113625767 13:111845371-111845393 AAGATTCCACAGGTTCTGGGTGG + Intergenic
1113668990 13:112162984-112163006 CAGACTCAAAAGATGCAGGATGG + Intergenic
1120321300 14:82964939-82964961 AAGAAACAATAGATGCTGGGAGG - Intergenic
1124169399 15:27359172-27359194 AAGATTGACTACATGCAGGGCGG + Intronic
1124717655 15:32080635-32080657 AAGAAACAACAGATGCTGGCAGG + Intronic
1125882071 15:43203696-43203718 AGGATTCAACTTAGGCAGGGGGG - Intronic
1126051420 15:44689204-44689226 AGGAAACAACAGATGCTGGGAGG + Intronic
1129148409 15:73670755-73670777 CAGATTCAATAGATGAAGGCTGG - Intergenic
1129617318 15:77108978-77109000 AATTTTAAACAGTTGCAGGGAGG + Exonic
1130097949 15:80870217-80870239 AAGAATCACCTCATGCAGGGTGG + Intronic
1130541774 15:84825649-84825671 AGGATTCAAATTATGCAGGGAGG + Intronic
1130792518 15:87170622-87170644 AAGATTAAGAAAATGCAGGGAGG - Intergenic
1132200744 15:99953113-99953135 AAGGTTCAACATATGAATGGGGG - Intergenic
1133244166 16:4436302-4436324 AAGATTGAAAAGATGGAGGCTGG + Intronic
1133707740 16:8371265-8371287 AAAATTAAACAAATGCAGGTGGG - Intergenic
1135005654 16:18819736-18819758 AAGATTCAAAAGAACCAGGGTGG + Intronic
1136091747 16:27925683-27925705 GAGATTCCACCGATGCAGGAAGG + Intronic
1136229711 16:28879183-28879205 AAGAATCTAAAGAGGCAGGGAGG - Intronic
1137689416 16:50411240-50411262 AAGATTCCACAGATGGAGGGTGG - Intergenic
1139502490 16:67378646-67378668 AAAATTCAACAGTTGGAGGAAGG + Exonic
1140555539 16:75916841-75916863 CAGATTCTACAGATGCAGGGTGG + Intergenic
1141215078 16:82016219-82016241 AGGATTCAAAAGAAGCAGGTTGG - Intergenic
1141253795 16:82382490-82382512 GAGATTGAGCAGGTGCAGGGTGG + Intergenic
1142317151 16:89355012-89355034 AAGACCCACCAGATGCAGGAAGG + Intronic
1143350154 17:6282160-6282182 AAGGCTGAATAGATGCAGGGAGG + Intergenic
1144189716 17:12833395-12833417 AAGAGTCAAGAGAGTCAGGGAGG - Intronic
1145067079 17:19768854-19768876 TAAATTCAACAGATGAAGGGAGG - Intergenic
1145791042 17:27626936-27626958 AAGATCACACAGCTGCAGGGTGG + Intronic
1146272004 17:31490702-31490724 AAAATTAGCCAGATGCAGGGTGG - Intronic
1146680243 17:34802056-34802078 AAGATGTAAAAGATGCAGGGTGG - Intergenic
1149136172 17:53367275-53367297 GAGATGGAACAGATGCAGAGAGG + Intergenic
1150539356 17:66080505-66080527 AGGAAACAACAGATGCTGGGAGG + Intronic
1155251301 18:23955871-23955893 AGTATTCAACAGAGGCTGGGTGG + Intergenic
1155340537 18:24810049-24810071 AAGATTCAACAGTTGATGGGAGG - Intergenic
1157890043 18:51406923-51406945 AACATTCAACAGCTGGAAGGTGG - Intergenic
1158181310 18:54717734-54717756 AAGAATCACCAGAAACAGGGAGG + Intergenic
1161827152 19:6575681-6575703 CAGATTGAATAGAAGCAGGGAGG - Intergenic
1161939574 19:7394490-7394512 AAGAATCAACGGATGCCTGGAGG - Intronic
1163861498 19:19745456-19745478 AACATTCAAGCGAGGCAGGGAGG + Intergenic
1165397194 19:35570906-35570928 AAGATGAAAAAGATGCAGAGAGG + Intergenic
924997039 2:371321-371343 ATTATCCAGCAGATGCAGGGTGG - Intergenic
926811143 2:16756424-16756446 TAGATACCACAGAGGCAGGGAGG - Intergenic
928192405 2:29184637-29184659 AAGAGACAACAGATGCTGAGTGG + Intronic
930189692 2:48444696-48444718 CAGATTCAATAGGTGCAGGGTGG - Intronic
931561105 2:63561862-63561884 AAGAAACAACAGATGCTGGCGGG + Intronic
931688707 2:64816870-64816892 AAGATTCAAAAGTTGAGGGGAGG + Intergenic
932134893 2:69219710-69219732 ATGATTCAGTAGATACAGGGTGG + Intronic
933766167 2:85711117-85711139 AAAACTCAACAGAGGCAGAGTGG - Intergenic
934018754 2:87921339-87921361 ATGATTCAATAGATGAAGTGTGG + Intergenic
935301027 2:101694130-101694152 AAGCTTCAACAAATGAATGGAGG - Intergenic
935508250 2:103934664-103934686 AAGATTCCAGTGATGGAGGGAGG + Intergenic
939505725 2:143044481-143044503 AAGAAACAACAGATGCTGAGAGG - Exonic
941513779 2:166446362-166446384 AGGAAACAACAGATGCAGGCAGG + Intronic
942230323 2:173855072-173855094 AGGACTCGACAGATGCAGGAGGG - Intergenic
942704002 2:178747411-178747433 AATATTCAACAGATGATGGTGGG + Intronic
943980550 2:194544329-194544351 ATGAAACAACAGATGCTGGGAGG + Intergenic
944404161 2:199362855-199362877 TAGATGCAAGAGAAGCAGGGAGG + Intronic
946395898 2:219443568-219443590 ACGATTCAACAGTAGAAGGGAGG + Intronic
947896289 2:233676188-233676210 AGGATTCATCAGAGGCATGGTGG - Intronic
948313746 2:237010755-237010777 AAGGTTCCACAGAAGTAGGGGGG - Intergenic
948565776 2:238885109-238885131 CAGATTGTGCAGATGCAGGGAGG + Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1170025170 20:11881451-11881473 GAGATTCAACAGATACAGAAAGG + Intergenic
1170392056 20:15886181-15886203 AAGATTCAACAGCTGGAAGCTGG + Intronic
1170459140 20:16560405-16560427 AAGAATCAGCAGGTGCAGTGAGG + Intronic
1172285235 20:33735612-33735634 AAATTTAAACAAATGCAGGGTGG - Intronic
1173833888 20:46112594-46112616 AAGAGTCAGCAGATGAAAGGTGG + Intergenic
1174768612 20:53276715-53276737 CAGATTCAATAGGTCCAGGGTGG + Intronic
1175558682 20:59897524-59897546 AAGATTCAACAGATTTAAGGTGG + Intronic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1178595242 21:33947575-33947597 GGGATGCAACAGATGGAGGGTGG + Intergenic
1179271708 21:39856511-39856533 AAGATGCAGCAGATGCAGTTGGG + Intergenic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1181679990 22:24488236-24488258 AAGAAACAACAGATTCAGGTTGG + Intergenic
1183111770 22:35654825-35654847 AAGAAGCAGCAGATGCAGGAAGG + Intronic
949446240 3:4136964-4136986 AAGAAACAACAGATGCCGGAGGG + Intronic
951334326 3:21403141-21403163 AATATACAACAGTTGCAGGAGGG - Intergenic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
954524538 3:51258136-51258158 AACATTCACCAGTTTCAGGGAGG - Intronic
956326724 3:68060933-68060955 ATGATTCAACAGATCCACAGTGG + Intronic
957545619 3:81632549-81632571 AGGAAACAACAGATGCTGGGAGG + Intronic
957582046 3:82086727-82086749 TAGATTCAAGTGATGCAGGTGGG + Intergenic
958458701 3:94366354-94366376 AAGAAACAACAGATGCTGGCAGG - Intergenic
959313529 3:104772703-104772725 AAGATCCCACAGAAGCAGAGAGG + Intergenic
960314666 3:116161912-116161934 TAGATTCAATAGATGGAGGTTGG + Intronic
962110633 3:132443089-132443111 AAGACTCCACGGATTCAGGGAGG - Intronic
962164145 3:133031520-133031542 AAGAAGCAACAGCTGCAAGGTGG + Intergenic
963083343 3:141414867-141414889 AAGTGTCAACAGAGGCAGAGAGG - Intronic
963921816 3:150912901-150912923 AAGAGTCAAGAGATTCCGGGTGG - Intronic
963981267 3:151539908-151539930 AAGAAACAAGAGGTGCAGGGAGG + Intergenic
967654598 3:192031827-192031849 CAGAGTCCACAGATGCATGGAGG - Intergenic
968265299 3:197358263-197358285 AAGATTTAGCAGCTGCAGGCTGG + Intergenic
969499272 4:7543280-7543302 ATGAGTCAACAGATGAACGGAGG - Intronic
969548060 4:7845062-7845084 AAGATTCAATACTAGCAGGGAGG + Intronic
970971191 4:21986094-21986116 AACATTCAAAAAATGAAGGGAGG + Intergenic
971620150 4:28845388-28845410 AGGACTCAACAGATGCAGAATGG - Intergenic
973083885 4:46030104-46030126 AAGATTGAAGAGATGAATGGGGG - Intergenic
973284303 4:48398160-48398182 AAGAAACAACAGATGCTGGCTGG - Intronic
973801833 4:54486004-54486026 AATATTTAACTGATGCAGTGAGG - Intergenic
976287901 4:83387699-83387721 GAGATTCAACAGATACAGAAAGG - Intergenic
977315219 4:95438719-95438741 TAGATTCATCAGATGCAGAATGG - Intronic
978160184 4:105537435-105537457 AAGAATCAAAACATGCATGGAGG - Intergenic
979042152 4:115812201-115812223 TAGATTCTACAGAGGCAGGCAGG - Intergenic
980136179 4:128860900-128860922 AAGCTTCACCAGATGCATGGAGG - Intronic
981972533 4:150682121-150682143 AAGATTCAACAAATGCACATTGG + Intronic
984078182 4:175209106-175209128 AAGAAACAGCAGATGCAGGAAGG - Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
985733659 5:1565248-1565270 AACTTTCACCAGGTGCAGGGAGG - Intergenic
986914970 5:12608311-12608333 AAGAAACAACAGATGCTGGCAGG - Intergenic
987903004 5:24037854-24037876 AGGAAACAACAGATGCTGGGAGG - Intronic
988607217 5:32689209-32689231 AAGATGCAGGGGATGCAGGGAGG - Intronic
988830099 5:34978645-34978667 AAGTTTCAACAAATGCAAAGAGG - Intergenic
989604475 5:43230730-43230752 AAGAAAGAACAGATGAAGGGGGG + Intronic
989672161 5:43931421-43931443 AAGAAACAACAGATGCTGGCAGG - Intergenic
990703243 5:58498075-58498097 AAGATTCAGCAGCTGTATGGTGG - Intergenic
991683036 5:69157249-69157271 AAAATTCAGCAGATGAAGGGTGG + Intergenic
993728610 5:91396877-91396899 GAGATTGATCACATGCAGGGGGG - Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
999225467 5:150019662-150019684 AAGATTCAACAGAATTTGGGTGG + Intronic
1000118119 5:158172268-158172290 AGGAATCAACATATGAAGGGAGG - Intergenic
1000796677 5:165672638-165672660 AAGATTTAATAGATGCTGGAAGG - Intergenic
1001278145 5:170365890-170365912 AGGATTCAACAAATGATGGGTGG + Intronic
1003958074 6:11184395-11184417 AAGATTGAACAGCCCCAGGGAGG + Exonic
1010084681 6:71903176-71903198 AAGAAACAACAGATGCTGGTGGG - Intronic
1010722550 6:79300274-79300296 GAGAAACAACAGATGCAGGAAGG - Intergenic
1010978106 6:82339397-82339419 AAGAAACAAAAGATGCAGGCTGG - Intergenic
1012326391 6:97924285-97924307 AAGATTCAGCTGATACTGGGGGG + Intergenic
1012492788 6:99800784-99800806 AAGTTTCAAGAGATGCAGAAAGG - Intergenic
1012529915 6:100222808-100222830 AGGAATCAACAGATGCTAGGAGG - Intergenic
1013932454 6:115550504-115550526 AAGAAACAGCAGATGCTGGGAGG + Intergenic
1014347811 6:120296885-120296907 AAGTTTCAAAATATGGAGGGAGG - Intergenic
1014628732 6:123762810-123762832 AAGATTCAACAGCTGTTAGGAGG + Intergenic
1021081582 7:16371090-16371112 AAGATTTATTAGATGAAGGGTGG - Intronic
1021303984 7:19008929-19008951 AAGGTTCAAGAGATGCTGAGTGG - Intergenic
1023289089 7:38650702-38650724 AGGAAACAACAGATGCTGGGGGG + Intergenic
1023513712 7:40979536-40979558 AAGTTTCACCAGATGCAGTCAGG - Intergenic
1026417043 7:70192884-70192906 AAGATACAACAAATGCAAGGAGG - Intronic
1027433437 7:78138132-78138154 AAAAGTCAAGAGATGCAGGGTGG - Intronic
1030884212 7:114919203-114919225 AAGATTCAACATATGAATGTTGG - Intergenic
1035844067 8:2844138-2844160 AAGGTTGAAAAGATGCAGTGTGG + Intergenic
1037412171 8:18609670-18609692 AAGATACAACTCACGCAGGGAGG + Intronic
1037599452 8:20381667-20381689 AAGATTCATCAGTTACAGGTGGG - Intergenic
1038245910 8:25855857-25855879 CAGATTCAATAGGTACAGGGAGG + Intronic
1041081213 8:54216630-54216652 AGAATTCAACAGATGAACGGGGG - Intergenic
1041503259 8:58562971-58562993 AGGATTCAACATATGAATGGAGG - Intronic
1042268401 8:66931844-66931866 TAGATTTAAAAAATGCAGGGCGG + Intergenic
1050319713 9:4439061-4439083 AAGAGACAACAGATGCTAGGTGG - Intergenic
1050911260 9:11074332-11074354 AAAACTCATCAGATGCTGGGAGG - Intergenic
1051708887 9:19909762-19909784 GAAAATCAACAGATGCAGGAAGG - Intergenic
1052749448 9:32474459-32474481 AAAATACAACAGATGCAATGTGG + Intronic
1056485108 9:87048338-87048360 AAAATTGAACAGATGCTAGGAGG + Intergenic
1058242372 9:102581571-102581593 TATATTCAACAAATGCAGTGGGG - Intergenic
1058258570 9:102801826-102801848 AAGAAACAACAGATGCTGGAAGG + Intergenic
1058386090 9:104437502-104437524 AAGAAACAACAGATGCTGGGAGG - Intergenic
1185477617 X:424875-424897 AAGGTTCATCGGATGCAGGCGGG - Intergenic
1185550562 X:980384-980406 AAGATTAAACAGCTGTTGGGGGG + Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1186902196 X:14068607-14068629 AAGATTGGACACATTCAGGGTGG + Intergenic
1187269765 X:17769128-17769150 AAGATTCAACAGATGCAGGGAGG - Intergenic
1189976022 X:46461916-46461938 TAGATGAAACAGAGGCAGGGAGG - Intronic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1191701771 X:64049736-64049758 AAGAAACAACAGATGCTGGTGGG + Intergenic
1191719367 X:64216682-64216704 AGGACTTAAAAGATGCAGGGTGG - Intergenic
1191857364 X:65637813-65637835 ACGATTCAATAGAGGCATGGTGG - Intronic
1193309714 X:79991628-79991650 AAGAATCAACAGATGCTGGCAGG + Intergenic
1194437012 X:93879185-93879207 AAGAAACAACAGATGCTGGCGGG + Intergenic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1198415716 X:136417693-136417715 AAGATTCAAAAGATACAAAGAGG - Intergenic
1198740889 X:139841545-139841567 AACATTCAAGAGCTGCAGAGAGG + Intronic
1199125776 X:144117797-144117819 ATGATTCAATAGATGAAGTGCGG - Intergenic
1200655239 Y:5893223-5893245 AAAAATCAACAAATGCAGGCAGG + Intergenic
1201322416 Y:12714748-12714770 TAGATTTAACAGATGGAGGCCGG - Intronic
1202337491 Y:23826923-23826945 AAGATTCTACAGGAGCAGGAGGG - Intergenic
1202533275 Y:25843148-25843170 AAGATTCTACAGGAGCAGGAGGG + Intergenic