ID: 1187272685

View in Genome Browser
Species Human (GRCh38)
Location X:17793017-17793039
Sequence CCTTCCCTGGACAGCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187272678_1187272685 -3 Left 1187272678 X:17792997-17793019 CCAGCTAGAGACAAACAGCCCCT No data
Right 1187272685 X:17793017-17793039 CCTTCCCTGGACAGCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187272685 Original CRISPR CCTTCCCTGGACAGCCTGGA GGG Intergenic
No off target data available for this crispr