ID: 1187273839

View in Genome Browser
Species Human (GRCh38)
Location X:17801660-17801682
Sequence CTGGGTGGTCATGACGTAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187273832_1187273839 -1 Left 1187273832 X:17801638-17801660 CCACGGGCAGTTGCACGGGGCCC 0: 1
1: 0
2: 1
3: 3
4: 104
Right 1187273839 X:17801660-17801682 CTGGGTGGTCATGACGTAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 113
1187273828_1187273839 5 Left 1187273828 X:17801632-17801654 CCAGCACCACGGGCAGTTGCACG 0: 1
1: 0
2: 4
3: 7
4: 48
Right 1187273839 X:17801660-17801682 CTGGGTGGTCATGACGTAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187273839 Original CRISPR CTGGGTGGTCATGACGTAGG TGG Exonic
900737129 1:4306068-4306090 CTGGGTGGTCTTGAGGTGGGAGG - Intergenic
900994364 1:6112489-6112511 CTGGGTGGTCCTGATGTGGTCGG - Intronic
901745870 1:11373106-11373128 CTGGGTGATCCTGACACAGGCGG + Intergenic
903381608 1:22900836-22900858 CTGCGTGGTCAGGACAGAGGAGG + Intronic
904018005 1:27438649-27438671 CTGTGTGGTCATGGAGCAGGTGG + Intronic
905706183 1:40060647-40060669 GGTGGTGGTGATGACGTAGGAGG - Intronic
906220165 1:44072046-44072068 TTGGGTGGTAATGATGGAGGTGG + Intergenic
907002991 1:50881264-50881286 CTAGGTGGTTGTGATGTAGGTGG + Intronic
907131910 1:52104701-52104723 CTGGATGGTAATGCGGTAGGTGG - Intergenic
907875292 1:58480577-58480599 CTGGGTCGTTATGATGAAGGGGG - Intronic
912717433 1:111991726-111991748 CTGGGTGGTCACTACTCAGGAGG + Intergenic
912822466 1:112878977-112878999 CTGGGTGGGCAGGAGTTAGGGGG - Intergenic
914258879 1:145982390-145982412 CTGGCTGGACATGACATACGAGG - Intergenic
919231418 1:194779525-194779547 CTGGGTGGTTTGGACTTAGGAGG + Intergenic
920231784 1:204475510-204475532 ATGGGTGGTCAGGATGTAGGTGG + Intronic
921523183 1:216182946-216182968 CTGGCTGGTCATCACATAGATGG - Intronic
922647473 1:227303715-227303737 ATGAGTGGTAATGACTTAGGAGG - Intronic
1069683498 10:70301330-70301352 CTGGGTGGGCATGAGGAGGGTGG + Exonic
1070717047 10:78730052-78730074 CTGGGTGGTGTTTACATAGGAGG - Intergenic
1075228499 10:120650837-120650859 TTGAGTGGTCATGACAAAGGTGG - Intergenic
1076735561 10:132457507-132457529 TGGGGTGGTCCTGACTTAGGCGG - Intergenic
1079455789 11:20635154-20635176 GTGGGTGTTGATGATGTAGGGGG + Intronic
1080717752 11:34820258-34820280 CTGGGTACTGATGACGTATGGGG - Intergenic
1085699014 11:78729724-78729746 CTGGGTGTTCAGGAGGTAGAGGG + Intronic
1090653053 11:128823929-128823951 CTGGGTGGTCAGGCCGGAGCTGG - Intergenic
1092287203 12:7135583-7135605 CTGGGTTGTCCTGAGGGAGGTGG - Intronic
1097087218 12:56477450-56477472 CTGAGTGGGGATGACGGAGGTGG + Exonic
1097993899 12:65866405-65866427 CTGGGTGGACTTGATGGAGGAGG + Intronic
1103460721 12:121102650-121102672 ATGGGTTGTCTTGAAGTAGGAGG - Intergenic
1104471947 12:129036464-129036486 CTGGGTGGACATGACTTTCGGGG - Intergenic
1104972785 12:132539487-132539509 CTGGGTGGGCATGAGGCTGGAGG - Intronic
1106897060 13:34314884-34314906 CATGGTGGTCATGAGGTAGCTGG - Intergenic
1108498313 13:51045970-51045992 CTGGGTGGACATGAATTTGGGGG - Intergenic
1114761461 14:25321273-25321295 CTGGGTGTTCTTGATGCAGGTGG + Intergenic
1118780227 14:69003055-69003077 CTGGTTGGCCATGAAGGAGGAGG - Intergenic
1119163379 14:72471702-72471724 CTGGGTGGTCAGGAGGTGGCTGG - Intronic
1120229789 14:81829759-81829781 CTGGGTGGACATGGCCTTGGCGG - Intergenic
1122264500 14:100540334-100540356 CTGTGGGGTCATGACATTGGAGG - Intronic
1131945060 15:97610147-97610169 CTGGGTGGTCATAACGCTCGTGG - Intergenic
1133996347 16:10751471-10751493 CTGGGTGCTGAGGAAGTAGGAGG + Intronic
1137012342 16:35335421-35335443 CTGGGTGGCCATGGCATAGAAGG + Intergenic
1137016708 16:35384288-35384310 CTGGGTGGTCATGGCATAGAAGG + Intergenic
1139593341 16:67944984-67945006 CTGGGTGGGCATGGCCCAGGTGG - Intronic
1143448611 17:7022868-7022890 AGGGGTGGTCGTAACGTAGGGGG - Intergenic
1143885329 17:10060905-10060927 ATGGGTTGTCATGACGGAGGTGG + Intronic
1144649227 17:16997099-16997121 CTGGGTGGACATGACTTTTGGGG - Intergenic
1147962605 17:44177236-44177258 CTGGGAGGCCCTGACATAGGAGG + Intronic
1151363297 17:73601384-73601406 CTGGGTGGACATGAATTTGGGGG - Intronic
1152917564 17:83049559-83049581 CTGGCTGGTCATGTTCTAGGTGG + Intronic
1156400067 18:36731916-36731938 CTGGGTGGGCATGAATTTGGGGG - Intronic
1157311995 18:46559791-46559813 CTGAGGGGTCATGAGGTAGGAGG - Intronic
1163425852 19:17240671-17240693 CCGGGTGGGCATGAGGAAGGAGG - Exonic
1165324287 19:35105090-35105112 TTGGGTGGTGTTGACCTAGGAGG - Intergenic
1167438930 19:49497023-49497045 CAGGGTGGTCATGTCTTAGAGGG + Intronic
925475297 2:4206517-4206539 TTGGGTGGTTCTGAGGTAGGAGG - Intergenic
926257093 2:11214137-11214159 CTGGTTGCTCATGAAGTAAGGGG - Intronic
927153863 2:20210809-20210831 CTGCGAGGTCATGAGGCAGGAGG + Intronic
930899140 2:56482353-56482375 CAGGGTGGTCAAGGGGTAGGTGG - Intergenic
932326192 2:70863470-70863492 CTGGGTGGACATGAATTTGGAGG + Intergenic
936030650 2:109067855-109067877 CAGGGTGGTCGTGATGGAGGAGG - Intergenic
940164293 2:150752201-150752223 CTGAGTGGTAGTGGCGTAGGAGG - Intergenic
941164015 2:162065995-162066017 CTGGGTGAATATGAAGTAGGAGG + Intronic
943343140 2:186705412-186705434 CTGCGTTGCCATGAGGTAGGAGG - Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
1175591950 20:60200415-60200437 CTGGGTGGTTTGGACCTAGGAGG - Intergenic
1179925423 21:44531559-44531581 CTGGGTGGACATGAATTCGGGGG + Intronic
1181279632 22:21709897-21709919 ATCGGTGGTCATGACGTATGAGG + Intronic
1181906931 22:26205562-26205584 CTGGGTGATTCTGATGTAGGTGG - Intronic
1182351917 22:29704279-29704301 CGGGGTGGTCAGGAGGTGGGAGG - Intergenic
1182351935 22:29704319-29704341 CGGGGTGGTCAGGAGGTGGGGGG - Intergenic
1183359128 22:37374329-37374351 CAGGATGGTCATGATGTAGTGGG + Exonic
1183828442 22:40405731-40405753 CAGGGTGGTGCTGAAGTAGGAGG - Exonic
950019522 3:9777314-9777336 CTGGGTTGTCATGAGGAGGGCGG - Intronic
954129870 3:48555116-48555138 CTGTGTGGTCCTGACTTAGGGGG - Intronic
954990634 3:54837936-54837958 CTGGGTGGACATGAACTTGGGGG + Intronic
956281054 3:67557393-67557415 CTTGGTGGTCAGGACGTGGTAGG - Intronic
957318277 3:78595656-78595678 GTGGGTGGTCAGGAAGCAGGCGG - Intergenic
957427273 3:80054012-80054034 CTGGCAGGACATGAGGTAGGAGG - Intergenic
958876286 3:99621425-99621447 TTTGGTGGTCATGAAGGAGGTGG - Intergenic
966902874 3:184499788-184499810 CTGGGTGCTCAAGACCTGGGTGG - Intronic
968494850 4:909978-910000 CAGGGTTGTCCTGACGTGGGTGG - Intronic
968922537 4:3530150-3530172 CAGGGTGGTCAGGAGGCAGGAGG - Intronic
970401231 4:15719688-15719710 CTGGGTGGAAATGACGTCAGTGG + Intronic
974176880 4:58335782-58335804 CTGGGTGCTCATGTATTAGGTGG - Intergenic
980752197 4:137105834-137105856 CTTGATGGTCATGAAGTGGGAGG - Intergenic
981948747 4:150380425-150380447 CTAGGTGATCCTGATGTAGGTGG - Intronic
986292998 5:6415351-6415373 CTGGGTGGGCATGAATTTGGGGG + Intergenic
988855993 5:35228847-35228869 CTGGGTGGTCTTGATACAGGAGG + Intronic
990967195 5:61461853-61461875 ATGGGTGGTAATGACTTAGCCGG + Intronic
995556053 5:113329913-113329935 CTTGGTGATCATGAAGAAGGGGG + Intronic
997679267 5:135737842-135737864 CTGGGTGCTGATGAAGTAGGAGG - Intergenic
1005911393 6:30313001-30313023 CTGGGTGGACATGAGTTTGGGGG - Intergenic
1008071964 6:47107044-47107066 CTGGTTGGTCATGGTGGAGGAGG - Intergenic
1009758698 6:67976261-67976283 CTGGGGGATCATGGAGTAGGTGG - Intergenic
1010748083 6:79587033-79587055 CCAGGTGGTCCTGACATAGGTGG + Intergenic
1014490966 6:122061119-122061141 CTGGGTGGTAGTGAGGTAGAAGG - Intergenic
1018640149 6:165897911-165897933 CTGGGTGGACATGAGGTGAGAGG - Intronic
1018945028 6:168341666-168341688 CTGGGTTGTCATGAAGTCTGTGG + Intergenic
1019344137 7:521332-521354 CTGGGTGGTCAGGACCAAGCGGG + Intergenic
1019577783 7:1745843-1745865 CAGGATGGTCATGATGTAGTGGG - Exonic
1020531768 7:9346904-9346926 TTAGGTGGTCATGAGGTGGGAGG + Intergenic
1026776102 7:73231914-73231936 CTGGTGGGTCATCAGGTAGGAGG + Intergenic
1027016959 7:74785285-74785307 CTGGTGGGTCATCAGGTAGGAGG + Exonic
1027071068 7:75160651-75160673 CTGGTGGGTCATCAGGTAGGAGG - Intergenic
1037809686 8:22080216-22080238 CAGGGTGGTCCTGCCATAGGCGG - Exonic
1038207886 8:25486018-25486040 CTGGGTGATTATGAAGTATGAGG - Intronic
1038852703 8:31295648-31295670 CTAGGAGGTCATGAGGTTGGAGG - Intergenic
1042711264 8:71719971-71719993 CTGGGTGGACATGAAGTCGGAGG + Intergenic
1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG + Intergenic
1049546440 8:143233847-143233869 CTGGGTGCTCATGAAGCTGGTGG - Intergenic
1057180008 9:93024688-93024710 CTGGGTGGGCAGGACCTGGGCGG + Intronic
1057439573 9:95073206-95073228 CTGGGCTGGCATGAGGTAGGAGG - Intronic
1057790343 9:98120314-98120336 CTGGGAGGCCATGAAGTGGGGGG - Intergenic
1062607181 9:137353532-137353554 CTGGGTGGCAATGACCAAGGGGG + Intronic
1062669086 9:137695785-137695807 CTGGGTGGACCTGAAGTATGTGG - Intronic
1185812555 X:3124257-3124279 CTGGGTTGTCAAGACTTAGAAGG + Intergenic
1187273839 X:17801660-17801682 CTGGGTGGTCATGACGTAGGTGG + Exonic
1191716624 X:64198110-64198132 CTGTGTGGTCATGTCATAGGAGG + Intronic
1193649915 X:84118493-84118515 CTGGGTGGTGATAAACTAGGAGG - Intronic
1194734847 X:97499909-97499931 CTGGCTGGACATGGCATAGGTGG + Intronic
1201268973 Y:12236007-12236029 CTGGGTTGTCAAGACTTAGAAGG - Intergenic
1202232097 Y:22668739-22668761 GTGGGTGGTCATGTACTAGGAGG + Intergenic
1202311059 Y:23527419-23527441 GTGGGTGGTCATGTACTAGGAGG - Intergenic
1202559743 Y:26143175-26143197 GTGGGTGGTCATGTACTAGGAGG + Intergenic