ID: 1187274765

View in Genome Browser
Species Human (GRCh38)
Location X:17807535-17807557
Sequence TACTCATCAATAAAAAGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187274765_1187274767 16 Left 1187274765 X:17807535-17807557 CCGACTCTTTTTATTGATGAGTA No data
Right 1187274767 X:17807574-17807596 GGCTGACTAAAACTTACACAAGG No data
1187274765_1187274766 -5 Left 1187274765 X:17807535-17807557 CCGACTCTTTTTATTGATGAGTA No data
Right 1187274766 X:17807553-17807575 GAGTAAGCTGCAACTCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187274765 Original CRISPR TACTCATCAATAAAAAGAGT CGG (reversed) Intronic