ID: 1187274765 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:17807535-17807557 |
Sequence | TACTCATCAATAAAAAGAGT CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1187274765_1187274767 | 16 | Left | 1187274765 | X:17807535-17807557 | CCGACTCTTTTTATTGATGAGTA | No data | ||
Right | 1187274767 | X:17807574-17807596 | GGCTGACTAAAACTTACACAAGG | No data | ||||
1187274765_1187274766 | -5 | Left | 1187274765 | X:17807535-17807557 | CCGACTCTTTTTATTGATGAGTA | No data | ||
Right | 1187274766 | X:17807553-17807575 | GAGTAAGCTGCAACTCAAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1187274765 | Original CRISPR | TACTCATCAATAAAAAGAGT CGG (reversed) | Intronic | ||