ID: 1187274766

View in Genome Browser
Species Human (GRCh38)
Location X:17807553-17807575
Sequence GAGTAAGCTGCAACTCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187274765_1187274766 -5 Left 1187274765 X:17807535-17807557 CCGACTCTTTTTATTGATGAGTA 0: 1
1: 0
2: 0
3: 46
4: 369
Right 1187274766 X:17807553-17807575 GAGTAAGCTGCAACTCAAAAAGG 0: 1
1: 0
2: 0
3: 19
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187274766 Original CRISPR GAGTAAGCTGCAACTCAAAA AGG Intronic
902677467 1:18018718-18018740 GAGGAAGCTGAGACTCAGAAAGG - Intergenic
903392098 1:22971772-22971794 GAGAAATCTGAGACTCAAAAGGG - Intergenic
905058817 1:35121844-35121866 GAGGAAGCTGGAACTCAGATGGG - Intergenic
905543100 1:38775848-38775870 GAGGAAGCTGAAACTCAGACGGG + Intergenic
907250615 1:53136013-53136035 GAGGAAGCTGAACCGCAAAAGGG + Intronic
909236526 1:73159638-73159660 GAGTTAGGTGCAAGGCAAAAGGG - Intergenic
909755070 1:79215496-79215518 GAGTAAGTTGAAACTCAGACAGG + Intergenic
909935815 1:81549410-81549432 GAGAAATCTGAAACTGAAAAAGG - Intronic
912569483 1:110610933-110610955 AAGTAAACTGCTACTCAGAAAGG - Intronic
914855555 1:151347616-151347638 GACTAAACTGAAACACAAAAGGG - Intergenic
917080931 1:171256323-171256345 GAGTAAACTGAGGCTCAAAAGGG + Intronic
917730046 1:177866059-177866081 GAGTCAGCTGCAGCAGAAAAGGG + Intergenic
918221964 1:182443605-182443627 AAGTAATCTAAAACTCAAAAGGG + Intergenic
919020712 1:192101516-192101538 AAGGAAGCTGGAACTTAAAATGG + Intergenic
920290594 1:204920546-204920568 GAGCAAGCTGCAAACCACAAAGG + Intronic
921419700 1:214932081-214932103 GAGTAAACTGAAACTCAGAGAGG + Intergenic
922352853 1:224748408-224748430 GAGTAAACTGGGACTCAGAAAGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1067833355 10:49622798-49622820 GAGGAAGCTGCAGCTCAGAGAGG + Intronic
1071106106 10:82096975-82096997 CAGAAAACTGCACCTCAAAAAGG - Intronic
1073756136 10:106582638-106582660 GTTTAAGCTGCAACTGGAAAGGG - Intronic
1079416623 11:20243857-20243879 GAGAAAACTGAAGCTCAAAAGGG + Intergenic
1080057296 11:27919485-27919507 GAGAAAGCTGCAGTTCAGAAAGG + Intergenic
1083108200 11:60378795-60378817 GAGTAAACTGAGACCCAAAAAGG - Intronic
1084900153 11:72303522-72303544 GACAAAACTGCAGCTCAAAAAGG - Intronic
1085214913 11:74820979-74821001 AAGGAAGCTGCAATTCAAAGAGG + Intronic
1085789916 11:79488239-79488261 GAGAAAACTGAAACTCAGAAAGG - Intergenic
1086062460 11:82714013-82714035 GAGGAAGCTGCAACTTATAGAGG + Intergenic
1088205898 11:107391931-107391953 CAGTAATATGCAACTCAAAAAGG + Intronic
1090141411 11:124267722-124267744 GAGTAAGCTACAGCTGTAAAGGG + Intergenic
1094691450 12:32773422-32773444 GATGAAGCTGAAACTCAAAATGG - Intergenic
1095244459 12:39902899-39902921 GAATAAGATGCAACTCAATAAGG - Intronic
1095646785 12:44557217-44557239 AAGTAATCTGTAACTCAAAAGGG - Intronic
1096427831 12:51519106-51519128 GAGGAAACTGAAGCTCAAAAAGG + Intergenic
1100101988 12:91120265-91120287 GAGGAAGCAGGAAGTCAAAATGG + Intergenic
1100326591 12:93545262-93545284 TAGTCAGCAGCATCTCAAAAGGG + Intergenic
1100605161 12:96146152-96146174 GAGAAAGCTAAATCTCAAAAAGG - Intergenic
1100698155 12:97117912-97117934 GAGCAAGCTGAAATTCAAAGAGG + Intergenic
1100777937 12:97992844-97992866 GAGAAAATTGAAACTCAAAAAGG + Intergenic
1101121227 12:101582374-101582396 CAATAAGCTGGAACTCAATAGGG - Intronic
1101531922 12:105581115-105581137 GAGGAAACTGAAACTCAAAGAGG - Intergenic
1101841382 12:108329831-108329853 GGGAAAACTGAAACTCAAAAAGG - Intronic
1103855616 12:123968074-123968096 GAGTAAGCTGCTTATAAAAAGGG - Intronic
1107929684 13:45296905-45296927 AAGTAAGTTCCATCTCAAAATGG + Intergenic
1108757538 13:53522103-53522125 GAGGAATCTGAAACTCAGAAAGG - Intergenic
1111506793 13:89201053-89201075 GATTAGGCTGAAACTCTAAATGG - Intergenic
1111701184 13:91692045-91692067 GAATAATCAGCAAGTCAAAATGG - Intronic
1113066924 13:106382152-106382174 GAGTAAACTGCAAGGCCAAAAGG + Intergenic
1114782485 14:25553779-25553801 GAACAAGAAGCAACTCAAAATGG - Intergenic
1117963862 14:61188052-61188074 AATTAACCTGAAACTCAAAAGGG - Intronic
1119087381 14:71750781-71750803 GAGGAAGCTGCAGCTCAGAAGGG + Intergenic
1119471820 14:74905330-74905352 GAGAAAACTGAAGCTCAAAAAGG - Exonic
1122112675 14:99513247-99513269 GACTTGGCTGCCACTCAAAATGG + Exonic
1122563426 14:102633512-102633534 GAGTTAGTTGCAATTAAAAATGG + Intronic
1127872062 15:63081989-63082011 GAGTAAACTGCAATTCAGAAAGG - Intergenic
1127959710 15:63881710-63881732 GAGGAAGCTGAGACTCAAAGGGG - Intergenic
1128331829 15:66761093-66761115 GAGGAAGCTGGAACTCAGATGGG + Intronic
1128461958 15:67876561-67876583 GAATCAGCTGCAATTCAAAATGG - Intergenic
1128617362 15:69120746-69120768 GAGAAAACTGCAACCCCAAATGG - Intergenic
1131322542 15:91408683-91408705 GAGGAAACTGCAACTCAGAAAGG + Intergenic
1131504478 15:93004435-93004457 GAGTAAGCTGCTAATCAGACAGG + Intronic
1132153211 15:99476801-99476823 GGGTAAGCTGCAGCTCAGGAGGG + Intergenic
1133335082 16:5001739-5001761 GAGGAAGCTGCTGCTCAGAAAGG - Intronic
1138916229 16:61468028-61468050 GAAGAAACTTCAACTCAAAAAGG + Intergenic
1139355923 16:66367013-66367035 GTGTATTCTCCAACTCAAAAAGG + Intronic
1144529478 17:16022240-16022262 GAGTAAGCTAAAACCCAAAGTGG - Intronic
1146119033 17:30173355-30173377 AAGAAATCTGAAACTCAAAAAGG + Intronic
1150328103 17:64273034-64273056 GAGGAAGCTGAGACTCAACAAGG - Intergenic
1151700866 17:75741955-75741977 GAGGAAGCTGAGGCTCAAAAGGG + Intronic
1152816691 17:82412245-82412267 GAGGAAGCAGCAGCTCAAATGGG + Intronic
1153035299 18:756598-756620 GAGGAAGATGCACCTCCAAAAGG + Exonic
1153788346 18:8555031-8555053 GAGAACTCTGCAACTCAGAAAGG + Intergenic
1157036623 18:43982964-43982986 GAATAAACTGAAACTAAAAAGGG - Intergenic
1157258321 18:46157629-46157651 GAAGAAGCTGCAGCACAAAATGG + Intergenic
1157608040 18:48938611-48938633 GAATAACCTACAACTCACAAGGG + Intronic
1158801877 18:60921079-60921101 GAGTAAGCTGCATGGCAAACTGG - Intergenic
1162139838 19:8579090-8579112 GAGTAAGCTGGAGTTAAAAAAGG + Intergenic
1165791464 19:38495161-38495183 GAGGAAACTGAAGCTCAAAAAGG - Intronic
925683296 2:6445542-6445564 GAGAAAGCTGCATCCCATAAAGG - Intergenic
925816811 2:7761091-7761113 CAGTAAGCTGGTATTCAAAATGG - Intergenic
926411344 2:12605737-12605759 GAGAAAACTGCAATTCAAAAGGG - Intergenic
927409687 2:22809957-22809979 GAGAAAACTGAAACTCAGAAAGG + Intergenic
927409699 2:22810349-22810371 GAGAAAACTGAAACTCAGAAAGG - Intergenic
929307404 2:40379213-40379235 GATTAAGCACCACCTCAAAACGG - Intronic
929412170 2:41709041-41709063 GCATAATCTGCAGCTCAAAAAGG - Intergenic
929416774 2:41750901-41750923 TATTATGCTGCAATTCAAAATGG - Intergenic
930390094 2:50749791-50749813 GAGTAAGGTGAAATTCAGAAAGG + Intronic
930607808 2:53510468-53510490 GAGTAAACTGAGACTCAAGATGG + Intergenic
932810527 2:74822020-74822042 GAGAAGGCTGTCACTCAAAATGG - Intergenic
938870874 2:135474911-135474933 AATTGAGATGCAACTCAAAAGGG + Intronic
939168278 2:138663418-138663440 AAGTAAACTGAAACTCAAAGAGG + Intergenic
939787350 2:146533454-146533476 GAGTAAGCTAAAACTAGAAACGG - Intergenic
941205197 2:162563309-162563331 TAGTAAGCAGCAACTGATAAGGG + Intronic
943506330 2:188764059-188764081 GAGAAAGCAGAAACTCAAAAAGG + Intronic
946208444 2:218128133-218128155 GAGTAAACTGAGACTCAGAAAGG + Intronic
946209247 2:218134207-218134229 GATTAAGCAGGAACTCCAAATGG - Intronic
946942503 2:224784351-224784373 TAATAAGCTGCAACTCATAGTGG + Intronic
1169183664 20:3593466-3593488 AAGGAAGCTGAAACTCAGAAAGG + Intronic
1173837896 20:46137788-46137810 GAGCAAGGTGCAGCTCAGAAAGG + Intergenic
1174647758 20:52100772-52100794 GAGTAAACTGAAGCTCAGAAAGG - Intronic
1175677871 20:60962313-60962335 GAAAAAGCTGCAACTCAGGAAGG + Intergenic
1176012921 20:62909727-62909749 GAGAAAGCTGCAAATCCAAGTGG - Exonic
1179433369 21:41341424-41341446 GAGGAAGCTGCATTTCAGAAGGG - Intronic
1183026583 22:35070036-35070058 GAGGAAGCTGAGACTCAATAAGG + Intronic
955071502 3:55575929-55575951 GAGTAAACTGAAACTCAGAGAGG + Intronic
959359557 3:105370433-105370455 GAGAAAACTGAAGCTCAAAAAGG - Intronic
959584345 3:108012228-108012250 GAGTAAGTACCAACTCAATATGG + Intergenic
960168876 3:114435474-114435496 GACTAAGCTGGAATTCAAATTGG + Intronic
961092368 3:124125239-124125261 GAGGAAACTGAATCTCAAAAAGG + Intronic
963032692 3:140994594-140994616 GACTAAGCTGGAAATCAACAAGG + Intergenic
965663515 3:171067060-171067082 GAGGAAACTGCATCTCAGAAGGG + Intronic
965669606 3:171133553-171133575 GAGGAAGCTGCATCTCAGGAAGG + Intronic
967215927 3:187210338-187210360 GAGGAAGCTGCAAATTAGAAGGG - Intergenic
967591074 3:191274222-191274244 GAGAAAACTGCATCTCAGAAGGG - Intronic
969336913 4:6516428-6516450 GAGCAAGCTGCACCTCAGAGAGG + Intronic
969727125 4:8926828-8926850 GAGTGAGCTGAAACTCCATAAGG - Intergenic
971241221 4:24890678-24890700 GATGAAGCTTCAACTCAAGATGG + Intronic
971423499 4:26494332-26494354 GAGCAAGCTGAGACTCAAAAAGG - Intergenic
973122840 4:46544064-46544086 GAAAAAGCTGCACCTGAAAAAGG - Intergenic
974761752 4:66285441-66285463 GAATAAGCTGCAACACAAATAGG - Intergenic
976486652 4:85613104-85613126 TAGTAAACTGTAACTTAAAAAGG - Intronic
977225870 4:94391079-94391101 GATGAGGCTGCACCTCAAAATGG + Intergenic
977585543 4:98771894-98771916 AAAGAAGATGCAACTCAAAATGG - Intergenic
977741264 4:100486601-100486623 GAGAAAGCTGCACCTGAAAGAGG + Intronic
978332678 4:107631670-107631692 TTGTAAGCTGCAACTCGAAAGGG + Exonic
982087269 4:151848491-151848513 AAGTTAGCTTCATCTCAAAAAGG + Intergenic
982251374 4:153410393-153410415 GAGTAAGTTGTAACTTTAAATGG - Intronic
985616320 5:923971-923993 GATGAAGCTGCAAGTCATAAAGG - Intergenic
986621887 5:9684525-9684547 GAGTAAGACCCATCTCAAAAAGG - Intronic
987456993 5:18159483-18159505 GAGTAAAGTGAAACACAAAAAGG + Intergenic
988042569 5:25908937-25908959 GAGAAAACTGAAACTCAAAAAGG - Intergenic
990138405 5:52675318-52675340 GGGTAAACCGCAACTCACAAGGG - Intergenic
990249677 5:53900460-53900482 GATTATGCTGTAACTGAAAATGG - Intronic
991370724 5:65916664-65916686 GAGGAAGCACCATCTCAAAAGGG - Intergenic
992185005 5:74235386-74235408 GAGAAAATTGAAACTCAAAAAGG + Intergenic
994756083 5:103795302-103795324 GAGTAAACTGCAAAAAAAAAAGG + Intergenic
995696378 5:114882891-114882913 CAGGAAACTGCAACTCAAAATGG - Intergenic
995742763 5:115372221-115372243 GAGGAAGCTGGAACACAAAGAGG - Intergenic
996812452 5:127532524-127532546 CATTAAGCTTCAGCTCAAAATGG - Intronic
996968849 5:129338875-129338897 GAGTAAGATGCAATTTTAAATGG - Intergenic
997155655 5:131553795-131553817 TATTAAGATGCAACTAAAAAGGG + Intronic
997614555 5:135237459-135237481 GAGGAAGCTGCAGCTCCAGATGG + Intronic
998891837 5:146754525-146754547 AATTAAGCTGCATCTCATAAGGG - Intronic
999083810 5:148869211-148869233 GAGAAAAATACAACTCAAAATGG + Intergenic
999083953 5:148870677-148870699 GAGAAAAATACAACTCAAAATGG - Intergenic
1000692700 5:164343047-164343069 GAGTAATCTGAAACACAGAATGG + Intergenic
1000774156 5:165396131-165396153 GAGTATGCTTGAACTCCAAAAGG - Intergenic
1001423986 5:171611570-171611592 GAGAAAGCTACCACTCAGAAAGG - Intergenic
1001766897 5:174256390-174256412 GAAGAAACTGAAACTCAAAAAGG - Intergenic
1005610680 6:27521375-27521397 CAGTAGGCTGCAAATCAAGAAGG - Intergenic
1009639571 6:66316023-66316045 GAGTAATCAGCAACCCAAAAAGG - Intergenic
1010036852 6:71335633-71335655 GATTACTATGCAACTCAAAAGGG + Intergenic
1010202096 6:73291033-73291055 GAGTAGGCTGCAGCTGAAAAAGG + Intronic
1011930097 6:92700981-92701003 GAGAAAGCTGTAACTCAAATGGG - Intergenic
1013899175 6:115132236-115132258 GAACAAGCTGTAACACAAAAAGG + Intergenic
1015235357 6:130964464-130964486 GAGGAAGCTGAAACTCAGCAAGG - Intronic
1020470308 7:8527179-8527201 TAGGAAGCGGCCACTCAAAATGG - Intronic
1021133025 7:16934119-16934141 GAGGAAGCTGGATATCAAAAAGG - Intergenic
1022957800 7:35397450-35397472 GAACAAAATGCAACTCAAAAGGG + Intergenic
1024061163 7:45699708-45699730 GAGTAGGCAGCAACTCTACAGGG - Intronic
1024905783 7:54377346-54377368 GAGTAAGCTTAAAATAAAAAAGG - Intergenic
1025090899 7:56063664-56063686 GAGAGAGCTGCAACTGTAAAGGG + Exonic
1027966944 7:85024141-85024163 GATTAAGCAGGGACTCAAAATGG + Intronic
1032540915 7:132702486-132702508 GAGAAACCTGAAACTCACAAAGG + Intronic
1033128073 7:138722215-138722237 AAGTAAGCTGCAGCACAGAAAGG + Intronic
1035940671 8:3897604-3897626 CCCTAAACTGCAACTCAAAATGG + Intronic
1039181202 8:34868634-34868656 GAGTCAGCTGCAAGTAAGAAGGG + Intergenic
1041440279 8:57887783-57887805 GAGTAAGGTGGAAATCTAAAGGG + Intergenic
1042105443 8:65321602-65321624 GAGTAAACATTAACTCAAAAAGG + Intergenic
1042415886 8:68518267-68518289 GAGGAAGCTGAAGCTCAACATGG - Intronic
1042831588 8:73034813-73034835 GAGGAAGCTGAGACTTAAAAAGG + Intronic
1043656965 8:82679748-82679770 GAGGAAGCTGCAACGAAAAGGGG + Intergenic
1046214372 8:111124339-111124361 GACTAAGGTGCACCTCATAAAGG - Intergenic
1046499321 8:115055217-115055239 GAGCAGGCTGGAACTTAAAAGGG - Intergenic
1048242840 8:132761312-132761334 GAGAAAACTGCAACTCAGAGGGG - Intergenic
1050142410 9:2530122-2530144 GAGTAAGCTACTAATGAAAATGG + Intergenic
1051351557 9:16202529-16202551 GAGAAAGCTGAAACTTAGAAAGG - Intergenic
1052301169 9:26954254-26954276 GAGGAAACTGAAACTTAAAACGG + Intronic
1058935346 9:109764630-109764652 GAATAAGGTGCAACTCTCAAGGG - Intronic
1059579896 9:115533531-115533553 GAGGAAGCTGGAACTCAAGCAGG + Intergenic
1059931196 9:119262774-119262796 GAGTAAAGTGAAACTCAAAGAGG - Intronic
1060110794 9:120904981-120905003 GAGGGAGCTCCAACTCAGAAGGG - Exonic
1060880232 9:127112949-127112971 GAGGAAACTGAAGCTCAAAAAGG + Intronic
1186352570 X:8755276-8755298 GTGGAAGCTGAAACTCAAACAGG - Intergenic
1186571916 X:10724009-10724031 GAGTAAGATGCCACTGAAGATGG - Intronic
1187274766 X:17807553-17807575 GAGTAAGCTGCAACTCAAAAAGG + Intronic
1190274068 X:48889144-48889166 GAGGAAACTGAAACACAAAAAGG - Intergenic
1190823403 X:53995417-53995439 GAGGAAACTGAAACTCAAAGAGG + Intronic
1193745386 X:85272936-85272958 TAGCATGCTGCAAATCAAAATGG + Exonic
1194401682 X:93445024-93445046 GAGGAATCTGAGACTCAAAAGGG - Intergenic
1195351940 X:104004663-104004685 GAATAGGCTGCATCTCAGAAAGG + Intergenic
1196568965 X:117243553-117243575 AAGTTAAATGCAACTCAAAAAGG + Intergenic
1198929166 X:141835047-141835069 GAGTAAACTGAAACACAAAAAGG - Intergenic
1199851686 X:151728318-151728340 CACTAAGCTCCAACACAAAATGG + Intergenic