ID: 1187280780

View in Genome Browser
Species Human (GRCh38)
Location X:17857305-17857327
Sequence CTGGAGCCACCGAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 291}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187280780_1187280786 8 Left 1187280780 X:17857305-17857327 CCCAGCTCCCTCGGTGGCTCCAG 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1187280786 X:17857336-17857358 GGAGTTTGAAGACTACCACCTGG 0: 1
1: 0
2: 1
3: 5
4: 84
1187280780_1187280791 19 Left 1187280780 X:17857305-17857327 CCCAGCTCCCTCGGTGGCTCCAG 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1187280791 X:17857347-17857369 ACTACCACCTGGTTGGAAGGGGG 0: 1
1: 0
2: 1
3: 11
4: 120
1187280780_1187280790 18 Left 1187280780 X:17857305-17857327 CCCAGCTCCCTCGGTGGCTCCAG 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1187280790 X:17857346-17857368 GACTACCACCTGGTTGGAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
1187280780_1187280796 27 Left 1187280780 X:17857305-17857327 CCCAGCTCCCTCGGTGGCTCCAG 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1187280796 X:17857355-17857377 CTGGTTGGAAGGGGGCTACGGGG 0: 1
1: 0
2: 0
3: 6
4: 88
1187280780_1187280788 16 Left 1187280780 X:17857305-17857327 CCCAGCTCCCTCGGTGGCTCCAG 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1187280788 X:17857344-17857366 AAGACTACCACCTGGTTGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 87
1187280780_1187280787 12 Left 1187280780 X:17857305-17857327 CCCAGCTCCCTCGGTGGCTCCAG 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1187280787 X:17857340-17857362 TTTGAAGACTACCACCTGGTTGG 0: 1
1: 0
2: 0
3: 4
4: 102
1187280780_1187280789 17 Left 1187280780 X:17857305-17857327 CCCAGCTCCCTCGGTGGCTCCAG 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1187280789 X:17857345-17857367 AGACTACCACCTGGTTGGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1187280780_1187280793 25 Left 1187280780 X:17857305-17857327 CCCAGCTCCCTCGGTGGCTCCAG 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1187280793 X:17857353-17857375 ACCTGGTTGGAAGGGGGCTACGG 0: 1
1: 0
2: 3
3: 16
4: 182
1187280780_1187280795 26 Left 1187280780 X:17857305-17857327 CCCAGCTCCCTCGGTGGCTCCAG 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1187280795 X:17857354-17857376 CCTGGTTGGAAGGGGGCTACGGG 0: 1
1: 0
2: 2
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187280780 Original CRISPR CTGGAGCCACCGAGGGAGCT GGG (reversed) Intronic
900151491 1:1180988-1181010 CTGGAGCCAGCCTGGGAGCCTGG - Intronic
900171343 1:1270625-1270647 CTGGACCCACGGGGGGAGTTGGG - Intronic
900567072 1:3338729-3338751 CTGGAGCCCCAGAGGCAGCCAGG + Intronic
901057256 1:6454363-6454385 CCGGCGCCACGGCGGGAGCTAGG + Intronic
901131186 1:6963148-6963170 CTGGAGCCTGCCAAGGAGCTGGG - Intronic
902263831 1:15247281-15247303 CTGGAGACTCCGCGGGAGCGCGG + Exonic
902383467 1:16063538-16063560 CTGGAGCCACGGTGGGAGTGCGG + Exonic
902477109 1:16694128-16694150 CTGGCGCCACGGCGGGAGCTGGG - Intergenic
902634426 1:17725921-17725943 CTGGAGCTTGCCAGGGAGCTGGG + Intergenic
902696982 1:18146686-18146708 GTGGAGCCACCGAGGGTCCCGGG + Intronic
903063193 1:20684430-20684452 CTGGGACCGCCGGGGGAGCTGGG - Intronic
903209166 1:21806592-21806614 CTGCAGCCTCCCAAGGAGCTGGG + Intergenic
903234206 1:21938952-21938974 CTGGTGCCGCCCAGTGAGCTGGG - Intergenic
903380925 1:22896359-22896381 CTGAAGGCGCCCAGGGAGCTGGG - Intronic
903565520 1:24262461-24262483 CTGGAGCCTTGGAGGGAGCATGG - Intergenic
904253287 1:29239237-29239259 CCGGAGCCATTCAGGGAGCTGGG - Intronic
904368772 1:30035284-30035306 CTGGAGCCACCCAGGGCATTGGG + Intergenic
907158319 1:52354133-52354155 TTGGAGCCACTGAGGGTGGTTGG - Intronic
907778083 1:57538406-57538428 ATGGAGCCAGGGAGGGAGGTAGG - Intronic
910058063 1:83055512-83055534 CTGGAGCCAGGGAGGAAACTTGG + Intergenic
911156999 1:94646722-94646744 CTGGGGCCTCCAAGGGAGGTAGG + Intergenic
915148283 1:153808605-153808627 CTGGAGCCAGAGAGGCAGGTGGG + Exonic
915586410 1:156846102-156846124 CTTGGGGCACCGTGGGAGCTAGG + Exonic
916170479 1:161998092-161998114 CTGGAGACACCGAGGTTGTTTGG + Exonic
918310208 1:183280219-183280241 TTGGAGCCACCCAGGGTTCTAGG + Intronic
919745187 1:201004360-201004382 CTGGAGGAGCCGAGTGAGCTTGG + Exonic
920234589 1:204494433-204494455 CTGGAGCCGCAGAGCGAGCCCGG - Intronic
921146620 1:212364260-212364282 CTGGTGTCCCCGAGGAAGCTGGG - Intronic
921377598 1:214490719-214490741 CTGTAGCCTCCGAAGTAGCTGGG - Intronic
921761783 1:218923478-218923500 CTGGAGTCAGGGAGCGAGCTGGG - Intergenic
921866151 1:220089743-220089765 CTGGACACAACGAGGGACCTGGG - Exonic
922279966 1:224114273-224114295 CCGGAGCCAGCGCGGGGGCTGGG - Exonic
922845326 1:228679932-228679954 CTCGAGCCAATAAGGGAGCTGGG + Intergenic
923066052 1:230518342-230518364 CTGAAGCCTCCCATGGAGCTGGG + Intergenic
923495264 1:234519227-234519249 CTGCAGCCACCGCGGGAGTGAGG + Intergenic
924704843 1:246492338-246492360 CTGGAATCACCTGGGGAGCTTGG - Intronic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1065122600 10:22543791-22543813 GTGAAGCCAGCCAGGGAGCTGGG + Intronic
1065313319 10:24437305-24437327 CTGGAGCAACCGTGCAAGCTTGG + Intronic
1067082563 10:43219755-43219777 CTACAGCCACCTAGGGTGCTGGG + Intronic
1068335913 10:55631524-55631546 CAGGAGCCACGGAGCGAGTTGGG - Intergenic
1071519441 10:86319905-86319927 CTGCTGTCACCGAGGGAGCTAGG - Intronic
1072515436 10:96176960-96176982 CTGCAGCCACTGAAGTAGCTGGG - Intronic
1074585794 10:114767431-114767453 CTGGAGCCAGCGACGATGCTGGG - Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076810658 10:132884785-132884807 CTGGTGCCACCAGGGGAGCCTGG + Intronic
1077103758 11:833196-833218 CTGGGGCAGGCGAGGGAGCTGGG - Intronic
1077128701 11:958009-958031 GTGGAGCCACGGAGGCAACTCGG - Intronic
1077514717 11:2994512-2994534 GTGGATCCTCTGAGGGAGCTGGG + Intergenic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077659543 11:4055289-4055311 CTGGAGCCAGGAAGGGAGCTGGG - Intronic
1079013213 11:16846652-16846674 CTTGAGCAACCTAGGGAGGTTGG + Intronic
1079251498 11:18791150-18791172 CTGAAGCCCCTGAGGGAGATTGG - Intronic
1080386221 11:31812653-31812675 CCGAAGCCGCCGAGAGAGCTCGG - Intronic
1080588237 11:33700179-33700201 ACGGAGCCAAGGAGGGAGCTAGG + Intronic
1083609175 11:63997027-63997049 CTGCAGCCACGGAGGGAGAAAGG - Intronic
1084562952 11:69914404-69914426 CTGCAGCCAGGGAGGGGGCTGGG + Intergenic
1085594276 11:77793729-77793751 ATGGAGCCAGTGAGGGAGGTAGG - Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1085749285 11:79146533-79146555 CTCTAGCCACCGAGGTACCTAGG + Intronic
1088857918 11:113773181-113773203 CTGGAAGCTCCGAGGAAGCTAGG - Intronic
1089508849 11:118982830-118982852 CTGCAGCCTCCCAGGTAGCTGGG + Intergenic
1090277703 11:125431478-125431500 CAGGAAGCACCGAGGGAGTTGGG + Exonic
1090398498 11:126434263-126434285 CAGGAGCCACCGAGGGGGGAAGG + Intronic
1090430738 11:126644295-126644317 CTGGAGCCACCAAGGGAAGTGGG + Intronic
1093707221 12:22287993-22288015 CTTCAGACACTGAGGGAGCTGGG - Intronic
1095690261 12:45080785-45080807 CGGGAGCCTGCAAGGGAGCTTGG - Intergenic
1095960861 12:47833475-47833497 CTGGAGCCAGCGAGGTAGACAGG + Intergenic
1096220163 12:49824113-49824135 CTGCAGCCTAGGAGGGAGCTTGG - Intronic
1096621954 12:52870711-52870733 CTGGTGCCGCCCTGGGAGCTGGG - Intergenic
1102236804 12:111298765-111298787 CTGGGCCCACCCTGGGAGCTTGG - Intronic
1103090987 12:118097958-118097980 CTGGAGCCACTGAGACAACTTGG - Intronic
1103104337 12:118209827-118209849 CTTGAGCCTCCGAAGCAGCTGGG + Intronic
1103547534 12:121712786-121712808 CTGGTGCCTCCGAGGGCGGTCGG + Exonic
1103558293 12:121779007-121779029 CGGAGGCCACCGAGGGGGCTGGG - Exonic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104992911 12:132636225-132636247 CTGGCGCCACAAAGAGAGCTGGG + Intronic
1106755808 13:32821726-32821748 CTGGAGCCCTTGAGGGAGCTTGG + Intergenic
1106776850 13:33016969-33016991 CTGGAGCGGCTGCGGGAGCTGGG + Exonic
1107975546 13:45685071-45685093 CCGCAGCCCCCGAGGTAGCTGGG - Intergenic
1107994976 13:45850778-45850800 CTGGAGCACCCTAGGCAGCTGGG - Intronic
1111574562 13:90135321-90135343 CTGGAGCCTCCCAAGTAGCTGGG - Intergenic
1113382999 13:109820795-109820817 CTGGAGCCTTCGAGGGAGCATGG - Intergenic
1113651532 13:112036967-112036989 GTGGAGACGCGGAGGGAGCTGGG - Intergenic
1113651546 13:112037021-112037043 GTGGAGACGCGGAGGGAGCTGGG - Intergenic
1113651575 13:112037128-112037150 GTGGAGACGCGGAGGGAGCTGGG - Intergenic
1113651604 13:112037235-112037257 GTGGAGACGCGGAGGGAGCTGGG - Intergenic
1113651618 13:112037289-112037311 GTGGAGACGCGGAGGGAGCTGGG - Intergenic
1113778022 13:112960031-112960053 CTGAAGTTACCGAGGGACCTCGG - Intronic
1114674107 14:24429820-24429842 CTGGAGCCGCCGAGGGGACTAGG + Intronic
1118691662 14:68345774-68345796 CTTCAGCCACCCAAGGAGCTGGG + Intronic
1118925795 14:70188804-70188826 CTGGCGGCTCCGAGGGACCTGGG + Exonic
1119421263 14:74509243-74509265 CAGGAGTCACCCAGGGGGCTGGG + Exonic
1120265680 14:82247911-82247933 CTGCAGCCTCCCAGGTAGCTTGG + Intergenic
1121328864 14:93037086-93037108 CAGGAGCCACCCAGGGAGCAGGG - Intronic
1121632092 14:95428837-95428859 CTGAAGCCACTGACGTAGCTGGG + Intronic
1122274845 14:100586271-100586293 CTGGGGCCTCCGACGGAGCCTGG + Intronic
1122833742 14:104421059-104421081 CTGGAGCCTCCGACGCAGCCTGG + Intergenic
1123123081 14:105927052-105927074 CTGGAGGCTCTGAGGGAGATGGG + Intronic
1123204036 14:106694774-106694796 CTGGAGCCACCGGGGGGGGGGGG - Intergenic
1123405719 15:20018470-20018492 CTGGAGGCTCTGAGGGAGATGGG + Intergenic
1123515049 15:21025118-21025140 CTGGAGGCTCTGAGGGAGATGGG + Intergenic
1127289169 15:57554873-57554895 CCGGAGCCCCAGAGGGAGCTTGG - Intergenic
1128731663 15:70025539-70025561 CTGGAGGCACCGAAGGGACTGGG + Intergenic
1129062095 15:72868306-72868328 CTGGGGCCACCCAGGTGGCTGGG - Intergenic
1129179928 15:73867577-73867599 TGGGGGCCACCGAGGGGGCTGGG - Intergenic
1129280582 15:74481609-74481631 CTGGAGCCAAGGAGGGTGCAGGG + Intergenic
1130303686 15:82699164-82699186 CTGGAGCCAGCCAGGGGGCCTGG + Intronic
1131510533 15:93047408-93047430 CTGAAGCCACGAAGGGAGGTGGG + Intronic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1134243475 16:12522924-12522946 CTGCAGCCACCCATGTAGCTGGG + Intronic
1135325674 16:21523916-21523938 CTGGAGCCCCCGAGGGAGTCTGG + Intergenic
1135829101 16:25757851-25757873 CAGGTGCCATCAAGGGAGCTGGG - Intronic
1136604134 16:31321254-31321276 CTGGAGCCTGGGAGAGAGCTTGG - Exonic
1137437786 16:48471616-48471638 CTGGAGCCTGCCAGGCAGCTTGG + Intergenic
1138104961 16:54282983-54283005 CGGGAGCAACCGCGGGGGCTTGG - Intergenic
1139518130 16:67463932-67463954 CTGAAGCCACTGGGGGAGGTGGG + Intronic
1139917107 16:70435343-70435365 CTGGAGCCTCCGAAAGTGCTGGG - Intronic
1140886927 16:79252603-79252625 CCTGAGCCACCAAGGTAGCTGGG + Intergenic
1141476767 16:84279319-84279341 CTGGGGCCACGGAGGGTGCATGG - Intergenic
1141995957 16:87636456-87636478 ATTGAGCAACCGAGGGAGCGAGG + Intronic
1142103125 16:88286058-88286080 ATGGAGGCACCGAGTGGGCTGGG - Intergenic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1143582037 17:7833326-7833348 CTGGAGCCTCCGGGAGAGCAGGG - Intronic
1143786360 17:9258758-9258780 CTGGAGCCACAGAGGAAGCCTGG - Intronic
1145255950 17:21322478-21322500 CTGAAACCAGCGAGGGAGCCAGG - Intergenic
1146833219 17:36088629-36088651 CTGGGCCCACCGAGGTCGCTGGG + Exonic
1147164627 17:38586677-38586699 ATGGAGCCCTGGAGGGAGCTGGG + Intronic
1147438319 17:40431497-40431519 CAGGAGCCACAGAGGGTGCTGGG + Intergenic
1147475314 17:40705946-40705968 CTTCAGCCTCCGAAGGAGCTGGG - Intergenic
1147585401 17:41651538-41651560 CTGGAGCCAGCGGGCCAGCTGGG - Intergenic
1147605648 17:41772386-41772408 CTGGAGTCTCTGAGGGAGCCTGG - Intronic
1147900162 17:43778659-43778681 CGGGAGCCACAGCGGGGGCTTGG - Intronic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1151180453 17:72323662-72323684 CTGGAGCCAGCCAGGGAGTGAGG - Intergenic
1152262126 17:79272933-79272955 CAGGAGCCTCCGAGGGTGGTGGG + Intronic
1152804624 17:82349364-82349386 CTGGAGCCACTGGGGTAGCCGGG + Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1153987688 18:10367995-10368017 CTGGAGTCAACGTGTGAGCTGGG + Intergenic
1155621763 18:27787380-27787402 CTGGAGCTCCAGAGGGAGTTTGG + Intergenic
1155862918 18:30926625-30926647 CTGGAGCCATCCTGGGTGCTAGG - Intergenic
1156047234 18:32890321-32890343 CTGAAGCCACCCAGAGAGGTGGG + Intergenic
1156326660 18:36079712-36079734 CTGCAGCCACTGTGGGAGATGGG - Intergenic
1159045536 18:63366520-63366542 CGGGACCCGCCGAGGCAGCTCGG - Intronic
1160411553 18:78678506-78678528 CTGGAGCCCCAGAGGGGGCAGGG - Intergenic
1160720287 19:594217-594239 CCGGTGTCACCGAGGGGGCTGGG + Intronic
1161171093 19:2812864-2812886 CGGGAGCCACCTCGGGAGTTTGG + Intronic
1161771190 19:6231615-6231637 CTGGAGCCTCCCAAGCAGCTGGG + Intronic
1161778431 19:6276558-6276580 CTGGGGCTGCCTAGGGAGCTGGG - Intronic
1162024862 19:7888252-7888274 CTGGGGAAACTGAGGGAGCTGGG - Intergenic
1163468975 19:17486123-17486145 CTGGTGCCACCCAGTGACCTGGG + Intronic
1163774140 19:19208175-19208197 CTGGACCCTCCAAGAGAGCTGGG - Intergenic
1164751179 19:30655921-30655943 CTGCAGCCTCCCAGGTAGCTGGG - Intronic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1165827620 19:38714227-38714249 CTGGAGGCACCGAGGAGGGTTGG - Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1166738987 19:45102896-45102918 CTGGAGCCACACAGGAGGCTGGG + Intronic
1166939079 19:46352063-46352085 CTGGAGCCACTCATGGAGCCTGG + Intronic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
1202711125 1_KI270714v1_random:19954-19976 CTGGCGCCACGGCGGGAGCTGGG - Intergenic
925251826 2:2445355-2445377 CTGGAGCGACCGTGGGTCCTAGG - Intergenic
925251835 2:2445392-2445414 CTGGAGCAACCGTGGGTCCTCGG - Intergenic
925944589 2:8849360-8849382 CTGGAGCCAGCCAGGGAGGAGGG + Intergenic
926147010 2:10402565-10402587 CTGGGGCCACCGAGGGCGGCTGG + Intronic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
927218485 2:20684158-20684180 CTGGAGACACTGAGGTATCTGGG - Intronic
929600214 2:43199985-43200007 CTGGAGCCAGGGAGGGAGGACGG - Intergenic
930002232 2:46869222-46869244 CAGGAGGCACACAGGGAGCTTGG - Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930059292 2:47274949-47274971 CAGCAGCCACCAAGGGACCTTGG + Intergenic
930741530 2:54836955-54836977 CTGAGGCCACCTAGGGAGCCTGG - Intronic
930887006 2:56337563-56337585 GTGGAGCCACAGATGGACCTGGG - Intronic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
932355431 2:71064607-71064629 CTGGAGTCACGGAGGGAGCCAGG - Intronic
932519798 2:72398579-72398601 CTGCAGCCACCTAAGTAGCTGGG - Intronic
933777189 2:85778373-85778395 CAGGTGCCACCGAGGGATCCAGG - Intronic
934165385 2:89289637-89289659 CTGGAGCCTCTGAAGGAGCCTGG - Intergenic
934201889 2:89892825-89892847 CTGGAGCCTCTGAAGGAGCCTGG + Intergenic
935744545 2:106179101-106179123 ATGGAGCCACAGAGGGAGACTGG - Intronic
935833576 2:107025526-107025548 CTGGAGCCTTCGAGAGAGATGGG + Intergenic
937045460 2:118848905-118848927 CCGGAGGCACCCAGGGAGTTGGG - Intergenic
940140196 2:150485350-150485372 CTGGAGCCCCCGAGGGACGCGGG - Intronic
942290752 2:174467850-174467872 CTCCAGCCACCCAGGTAGCTGGG + Intronic
942746847 2:179244006-179244028 CTGGAGCCTCCCAAGTAGCTAGG - Intronic
944322670 2:198366373-198366395 CTGGAGCCTCCCAAGTAGCTAGG + Intronic
946157006 2:217813596-217813618 CTGGAGGGACCCAGGGTGCTGGG - Intronic
948922686 2:241073127-241073149 CTGGGGCCACGCAGGGAGCCTGG + Intronic
1169074479 20:2752503-2752525 GTGGAGCCATTGAGGAAGCTGGG - Exonic
1170249965 20:14270471-14270493 CTTCAGCCTCCCAGGGAGCTCGG - Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1173812273 20:45963390-45963412 CTGGTGCCACTGAGGGAGAATGG - Intronic
1174127395 20:48317053-48317075 CTGAAGCCACGGAGGAAGCATGG + Intergenic
1174302771 20:49594292-49594314 CAGAAACCACCGAGGGAGCTGGG + Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1175443847 20:59007381-59007403 CCGGAGCCAGGGAGGGAGCGGGG - Intergenic
1176000012 20:62827454-62827476 CTGGGGCCAGGGAGAGAGCTCGG - Intronic
1176061124 20:63173472-63173494 CTGGCCCCACCTAGGGATCTTGG - Intergenic
1176551330 21:8223762-8223784 CCGGAAACACGGAGGGAGCTTGG + Intergenic
1176570239 21:8406761-8406783 CCGGAAACACGGAGGGAGCTTGG + Intergenic
1176578148 21:8450948-8450970 CCGGAAACACGGAGGGAGCTTGG + Intergenic
1179133549 21:38660473-38660495 CTGTAGCCAGCGTGGGAGCCGGG + Intronic
1179269591 21:39840497-39840519 CAGGGGCCTCCGAGGGAGCGTGG - Intergenic
1179639058 21:42735238-42735260 GTGGAGCCTCCGGGGGACCTAGG - Intronic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181568034 22:23751453-23751475 CAGAAGCCACTGAGGCAGCTGGG + Intergenic
1181614094 22:24040154-24040176 CTGGAGGGACAGAGGTAGCTGGG + Intronic
1182985776 22:34714770-34714792 CTGGAGCCTCGAAGGGAGCATGG + Intergenic
1183314267 22:37128436-37128458 CTGGGGCCACCGAGGAGACTGGG + Exonic
1183546067 22:38455377-38455399 CGGGTGACAGCGAGGGAGCTGGG - Intergenic
1183663331 22:39234003-39234025 CGGGAGCCACGGAGGGAGGGAGG + Intronic
1184251035 22:43260470-43260492 CTTGAGCCACAGAGGCTGCTTGG + Intronic
1184488183 22:44793972-44793994 CTGGGGAGACCGAGGGAGCGAGG + Intronic
1184784109 22:46663518-46663540 CTGGGGGTCCCGAGGGAGCTAGG + Intronic
1203256353 22_KI270733v1_random:140706-140728 CCGGAAACACGGAGGGAGCTTGG + Intergenic
949944747 3:9180978-9181000 CTGGAGACACGGAGGCAGCCGGG + Intronic
952793451 3:37218306-37218328 CTGCAGCCTCCCAGGGAGCTGGG + Intergenic
954137071 3:48586847-48586869 CTGGAGCCTGTGAGAGAGCTGGG + Intronic
954179917 3:48873491-48873513 CTTCAGCCACCCAGGTAGCTGGG - Intronic
954493495 3:50930598-50930620 CTGGAGCCACCAAGGGAGCCTGG - Intronic
955313139 3:57910297-57910319 CTGGAGCCTCCCAAGTAGCTGGG + Intronic
957451523 3:80387625-80387647 CTAGACCTAACGAGGGAGCTGGG - Intergenic
960619077 3:119621894-119621916 CTGGAGGCCCCAAGGGAGCTAGG - Intronic
962346662 3:134623870-134623892 CTGGAGCCATCAAAGGGGCTGGG - Intronic
963038051 3:141049504-141049526 CTGGAGCCCCCAAGGGAGGGGGG + Intergenic
967133834 3:186496589-186496611 CTGCAGCCTCTGAGAGAGCTGGG - Intergenic
967697296 3:192546933-192546955 CTGCAGCCTCCGAAGTAGCTAGG - Intronic
968759323 4:2433878-2433900 CTGGGGACTCCGAGGGAGCTGGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969311649 4:6356451-6356473 CTGGAGCCACGGAGGGCGTATGG - Intronic
969581996 4:8071146-8071168 CTGCCCCCACAGAGGGAGCTGGG - Intronic
969600500 4:8173267-8173289 CTGCAGCCTCCCAGGTAGCTGGG - Intergenic
971292029 4:25351943-25351965 TTGGAGTCACCCAAGGAGCTTGG - Intronic
971355129 4:25888467-25888489 CTGAAGCCACCGGTGGAGGTGGG - Intronic
975825983 4:78320106-78320128 CTGGAGCCTCCCAGGGAGCAGGG - Intronic
978665684 4:111178243-111178265 CTGCAGCCACCCAGGTAGCTGGG + Intergenic
980269417 4:130564514-130564536 CTTCAGCCTCCGGGGGAGCTGGG + Intergenic
981322751 4:143411585-143411607 CTGGAGCTACCAAGGCAGCAAGG + Intronic
984990410 4:185375189-185375211 CTGCAGCCTCCCAGGTAGCTGGG + Intronic
985520257 5:370801-370823 CTCCAGCCACCCAGGGAGGTCGG - Intronic
985606950 5:862928-862950 CTGGAGCCCCAGTGGAAGCTGGG + Intronic
985990550 5:3556805-3556827 CTGGAGCCCCTCATGGAGCTTGG + Intergenic
986632216 5:9784680-9784702 CTGGAGCTTCTGAGGGAGCGGGG - Intergenic
987193277 5:15500470-15500492 CTGGAGCCACCGGGGGTGCCAGG + Exonic
987326838 5:16820076-16820098 CTGGGGCCACCTAGGGAGCAGGG + Intronic
987456281 5:18151043-18151065 CTGGAGCAACTTATGGAGCTGGG - Intergenic
987457380 5:18164328-18164350 CTTCAGCCACCCAAGGAGCTGGG + Intergenic
991202335 5:64008862-64008884 CTGCAGCCACCACGGAAGCTGGG + Intergenic
991384783 5:66073992-66074014 CTTGAGCCTCCCAAGGAGCTGGG + Intronic
991436086 5:66597585-66597607 CCAGCGCCACCGAGGGAGCGCGG - Intronic
991923533 5:71681330-71681352 CTGAAGCCACCAAGGGAGTCTGG + Intergenic
992542749 5:77780608-77780630 CTTGGGCCACCGAGGTACCTTGG + Intronic
993701126 5:91120603-91120625 CTGAGGCCACCCTGGGAGCTGGG - Intronic
994244322 5:97462144-97462166 CTGCAGCCACCGAAGGACATTGG + Intergenic
997308206 5:132856209-132856231 CTTCAGCCTCCCAGGGAGCTTGG - Intergenic
997308396 5:132857796-132857818 CTTCAGCCTCCCAGGGAGCTGGG - Intergenic
997599931 5:135132236-135132258 CTGGAGCCATGGGGGGAGCTGGG + Intronic
998134541 5:139667903-139667925 CTGGAGCCACCGCAGCTGCTGGG - Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999199627 5:149806471-149806493 CAGGAGAGACCGAGGGAGCAGGG - Intronic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1000288404 5:159847336-159847358 CTGGCGCCAGAGTGGGAGCTGGG - Intergenic
1001044529 5:168361648-168361670 CTGGAGCCACCCAAGGACCCAGG - Intronic
1003893790 6:10587706-10587728 CCTGAACCAACGAGGGAGCTTGG - Intronic
1004464029 6:15866776-15866798 CTGGAGCCTCAGAGGGTGTTGGG - Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1005993437 6:30917672-30917694 CTGGAGGCACCGAGAAAGCTGGG - Intronic
1006813322 6:36834957-36834979 CTGGAGCCAGAGAGGCAGCCCGG - Intronic
1010980480 6:82364618-82364640 CTGGATCCTCTGAGGGACCTGGG - Exonic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1016278684 6:142386767-142386789 CTGGAGCCATCTGGGCAGCTCGG + Intronic
1016729849 6:147417548-147417570 CTGGTGCCACCCTGGGATCTGGG + Intergenic
1017034580 6:150255827-150255849 CTGCAGCCACCCAGGGAGCCAGG + Intergenic
1017153762 6:151304690-151304712 CTGCAGCCTCCCAGGTAGCTGGG + Intronic
1019172700 6:170142972-170142994 CAGGAGCCACCCAGGGGCCTCGG - Intergenic
1019257902 7:63379-63401 CTGGAGCTACCCTGGGGGCTGGG + Intergenic
1019518842 7:1451612-1451634 CTGGCCCCACAGAGGGAGCTGGG + Intronic
1022488384 7:30797978-30798000 CTGGAGGCACTGAAGGACCTGGG + Intronic
1024174739 7:46827601-46827623 CTGCAGGCTCCGTGGGAGCTAGG + Intergenic
1025030825 7:55555291-55555313 CTGGGGCCAGCGATTGAGCTGGG - Intronic
1029128497 7:98312223-98312245 CTCCTGCCACCGAGGCAGCTTGG + Exonic
1029363417 7:100102452-100102474 ATGGAGTCACGCAGGGAGCTGGG - Intronic
1032193141 7:129775712-129775734 CTGCAGCCACCCAGGTGGCTTGG + Intergenic
1032522433 7:132555989-132556011 ATGGAGCCACAGAGGGCTCTAGG - Intronic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG + Intergenic
1034980824 7:155475160-155475182 CTGGGGCCACTGAAGAAGCTGGG - Intronic
1035198561 7:157243564-157243586 CTGGCCCCTCCCAGGGAGCTTGG + Intronic
1037089487 8:14896590-14896612 CTGCAGCCTCCTAGGTAGCTGGG + Intronic
1037762828 8:21753112-21753134 CTGAAGCCCCCGAATGAGCTGGG - Intronic
1037881024 8:22573581-22573603 CTGGAGGAAATGAGGGAGCTGGG + Intronic
1037886894 8:22600058-22600080 CCGCAGCCACGGAGGGGGCTGGG - Intronic
1037902002 8:22693968-22693990 CTGGAGCCGCTGAGGTAGCAGGG - Intergenic
1039475130 8:37835616-37835638 CTGGGGGCACCGGGGGAGCCAGG - Exonic
1041424417 8:57703964-57703986 CTGGAGCCACAGAGAGGGATGGG - Intergenic
1042612611 8:70615038-70615060 AGGGAGCCAGTGAGGGAGCTGGG + Intronic
1044316224 8:90752012-90752034 CTGGATCCACCAAGGAAGCCAGG - Intronic
1049048451 8:140171867-140171889 CAGGAATCACCGAGGGTGCTAGG + Intronic
1049566331 8:143341058-143341080 CAGGGGCCGCCGTGGGAGCTGGG - Intronic
1049691780 8:143964537-143964559 CTGGAGCCTCCGAAGGAGCGTGG + Intronic
1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG + Intronic
1057387908 9:94620750-94620772 CTGGGGCCTCTCAGGGAGCTGGG + Intronic
1057847541 9:98537076-98537098 CTGAAGCCACCTGGAGAGCTTGG + Intronic
1057875342 9:98749318-98749340 CTGGGGTCAGGGAGGGAGCTGGG - Intronic
1059303424 9:113334117-113334139 CTTCAGCCTCCCAGGGAGCTGGG + Intronic
1059545372 9:115170704-115170726 CTGTAGCCACCAGGGGAGCAGGG - Intronic
1059762204 9:117349031-117349053 CTGGTGCCATAGAGAGAGCTAGG + Intronic
1060282067 9:122221445-122221467 CTGGAGCCCGCGACAGAGCTTGG + Intronic
1060558355 9:124521866-124521888 CTGGGGGCCCCGAGGGAGCTGGG + Exonic
1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG + Intergenic
1062314607 9:135960696-135960718 CTGCAGCCACGCAGGGAGGTAGG - Intronic
1203472509 Un_GL000220v1:122406-122428 CCGGAAACACGGAGGGAGCTTGG + Intergenic
1186376273 X:9005153-9005175 CATGAGCCACCGAGGGAGGTGGG + Intergenic
1186464640 X:9775380-9775402 CAGGAGCCACGGAGAGAGGTGGG + Intronic
1186872211 X:13784169-13784191 CTGGAATCACCTGGGGAGCTTGG + Intronic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1190881480 X:54495455-54495477 CTGGAGCCAAGCGGGGAGCTCGG - Exonic
1190928448 X:54928957-54928979 CTGAAGCCACCACTGGAGCTGGG - Exonic
1191720899 X:64227672-64227694 CTGGAGCTAAAGAGAGAGCTGGG - Intronic
1195766215 X:108298769-108298791 CTGGTGCCTCCAAGGGACCTTGG + Intronic