ID: 1187281270

View in Genome Browser
Species Human (GRCh38)
Location X:17860435-17860457
Sequence CCGGGGTGGCCGCACCAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187281270_1187281286 1 Left 1187281270 X:17860435-17860457 CCGAGCTGGTGCGGCCACCCCGG No data
Right 1187281286 X:17860459-17860481 GCTGGGCATTGGGGGGCACCGGG No data
1187281270_1187281290 11 Left 1187281270 X:17860435-17860457 CCGAGCTGGTGCGGCCACCCCGG No data
Right 1187281290 X:17860469-17860491 GGGGGGCACCGGGGCTCCCGGGG No data
1187281270_1187281276 -10 Left 1187281270 X:17860435-17860457 CCGAGCTGGTGCGGCCACCCCGG No data
Right 1187281276 X:17860448-17860470 GCCACCCCGGGGCTGGGCATTGG No data
1187281270_1187281289 10 Left 1187281270 X:17860435-17860457 CCGAGCTGGTGCGGCCACCCCGG No data
Right 1187281289 X:17860468-17860490 TGGGGGGCACCGGGGCTCCCGGG No data
1187281270_1187281278 -9 Left 1187281270 X:17860435-17860457 CCGAGCTGGTGCGGCCACCCCGG No data
Right 1187281278 X:17860449-17860471 CCACCCCGGGGCTGGGCATTGGG No data
1187281270_1187281285 0 Left 1187281270 X:17860435-17860457 CCGAGCTGGTGCGGCCACCCCGG No data
Right 1187281285 X:17860458-17860480 GGCTGGGCATTGGGGGGCACCGG No data
1187281270_1187281287 2 Left 1187281270 X:17860435-17860457 CCGAGCTGGTGCGGCCACCCCGG No data
Right 1187281287 X:17860460-17860482 CTGGGCATTGGGGGGCACCGGGG No data
1187281270_1187281288 9 Left 1187281270 X:17860435-17860457 CCGAGCTGGTGCGGCCACCCCGG No data
Right 1187281288 X:17860467-17860489 TTGGGGGGCACCGGGGCTCCCGG No data
1187281270_1187281282 -6 Left 1187281270 X:17860435-17860457 CCGAGCTGGTGCGGCCACCCCGG No data
Right 1187281282 X:17860452-17860474 CCCCGGGGCTGGGCATTGGGGGG No data
1187281270_1187281279 -8 Left 1187281270 X:17860435-17860457 CCGAGCTGGTGCGGCCACCCCGG No data
Right 1187281279 X:17860450-17860472 CACCCCGGGGCTGGGCATTGGGG No data
1187281270_1187281280 -7 Left 1187281270 X:17860435-17860457 CCGAGCTGGTGCGGCCACCCCGG No data
Right 1187281280 X:17860451-17860473 ACCCCGGGGCTGGGCATTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187281270 Original CRISPR CCGGGGTGGCCGCACCAGCT CGG (reversed) Intronic