ID: 1187281602

View in Genome Browser
Species Human (GRCh38)
Location X:17861444-17861466
Sequence GGTGATCTCGCCCACGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187281593_1187281602 6 Left 1187281593 X:17861415-17861437 CCCGAGGAGGCGGCGGCGGAGGA 0: 1
1: 3
2: 14
3: 129
4: 671
Right 1187281602 X:17861444-17861466 GGTGATCTCGCCCACGGGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 73
1187281594_1187281602 5 Left 1187281594 X:17861416-17861438 CCGAGGAGGCGGCGGCGGAGGAG 0: 1
1: 2
2: 23
3: 159
4: 1108
Right 1187281602 X:17861444-17861466 GGTGATCTCGCCCACGGGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187281602 Original CRISPR GGTGATCTCGCCCACGGGGA GGG Intergenic
902141545 1:14361052-14361074 GGTGCTCTGTCCCACGGAGATGG + Intergenic
902906674 1:19563463-19563485 GGTGTTCTCTCCCCTGGGGATGG + Intergenic
911217956 1:95216322-95216344 GGTGCTCTGTCCCAGGGGGATGG + Intronic
911692003 1:100845258-100845280 GGTGCTCTGGCCCAGGGAGATGG + Intergenic
915587010 1:156849367-156849389 GTAGATCTTGCCCACGGGAATGG + Exonic
917915256 1:179694873-179694895 GGTGCTCTCTCCCAGGGAGATGG - Intergenic
920555326 1:206900119-206900141 GCTGAGCTGGCCCATGGGGAGGG - Intronic
920869012 1:209777726-209777748 TGTGATCTGGCCCAGAGGGATGG - Intronic
923081363 1:230658669-230658691 GGTGCTCTGTCCCACGGGGATGG + Intronic
1065144251 10:22751953-22751975 GGTGATCTGGCCCAATGGCAGGG + Intergenic
1065427465 10:25620035-25620057 GGTGCTCTGTCCCACGGAGATGG - Intergenic
1069920530 10:71812993-71813015 GGTGTTCTCGCCCCAGTGGAGGG - Intronic
1073178113 10:101568901-101568923 GGTGATCTCAAACAAGGGGAGGG + Intergenic
1074235261 10:111578391-111578413 TGAGATCTCTCCCATGGGGATGG - Intergenic
1075800781 10:125152122-125152144 GGTGTTCTGGCCCGCGGGGGCGG + Intronic
1091848083 12:3672958-3672980 GCTGATCTGGCCCTGGGGGATGG + Intronic
1097516051 12:60607931-60607953 GGTGATGTAGCGCACTGGGAAGG - Intergenic
1097898761 12:64853106-64853128 GGTGCTCTCTCCCAGGGAGATGG + Intronic
1099744940 12:86689931-86689953 GGTGCTCTGTCCCAGGGGGATGG + Intronic
1100073891 12:90755101-90755123 GGTGATCTGTCCCAGGGAGATGG + Intergenic
1104914544 12:132257944-132257966 GGTCCACTCGCCCACAGGGAGGG + Intronic
1105801146 13:23903931-23903953 GATGATCATGCCCACGGGGTGGG - Intergenic
1108599903 13:51983435-51983457 GGTGATCTGTCCCAGGGAGATGG - Intronic
1114614273 14:24059993-24060015 GGAGATGTCGCTCACGGGGAAGG - Exonic
1114617085 14:24074118-24074140 GGTGATCTTGCCTACCGTGATGG - Exonic
1124464012 15:29919892-29919914 TGTCATCTCCCCCACTGGGAAGG - Intronic
1129707761 15:77804464-77804486 GGTGAGCTCCCCATCGGGGAGGG + Intronic
1131310924 15:91289302-91289324 GGTGATCTGACCCACGCAGAGGG + Intronic
1133316157 16:4885316-4885338 GGTGATCTTGCCCTCGGCCATGG + Exonic
1137296359 16:47097546-47097568 GGTGCTCTGTCCCACGGAGATGG - Intronic
1139935924 16:70571145-70571167 GGTGGTCCCGCCCACAGAGAGGG - Exonic
1148981071 17:51575230-51575252 GGTGCTCTCTCCCAGGGAGATGG - Intergenic
1150655406 17:67035953-67035975 GGTGACCTCCCCCACTGGGATGG - Intergenic
1151557123 17:74852186-74852208 GCTGATGAGGCCCACGGGGAAGG + Exonic
1161316238 19:3618912-3618934 GGAGATCTCGTCCTCGGTGATGG + Exonic
1167672015 19:50858980-50859002 GGTGATCAGGCTCTCGGGGAGGG + Intronic
928380667 2:30814889-30814911 GGAGGTCTCTCCCATGGGGATGG - Intronic
935959793 2:108413706-108413728 TGGGCTCTCGCCCATGGGGAGGG + Intergenic
941819257 2:169828063-169828085 GGTCGCCTCGCCCGCGGGGAGGG - Intronic
945673859 2:212832645-212832667 GATGGTCTCGGCCACGGGCATGG - Intergenic
948879837 2:240851037-240851059 GGTGACCTGGCTCTCGGGGAGGG - Intergenic
949052006 2:241902556-241902578 GGTGATGCCGCACACGGGGAAGG - Intergenic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1175877117 20:62235605-62235627 GGTGACCTCCCCCATGGTGAGGG + Intronic
1183739999 22:39664131-39664153 TGTCATCTCGCCCACGAAGATGG - Exonic
950098740 3:10344873-10344895 GGGGATCTTGCTCACTGGGAAGG - Intronic
950399286 3:12758527-12758549 GGTGGTGTGGCCCAAGGGGAGGG - Intronic
961310629 3:125997100-125997122 GGTGCTCTGGCCCAGGGAGATGG - Intergenic
963801878 3:149684342-149684364 GATGATATCGCCTACAGGGAAGG + Intronic
967814391 3:193787060-193787082 GAGGATCTCCCCCACGGGGCGGG + Intergenic
980151632 4:129055399-129055421 GGTGCTCTGTCCCAGGGGGATGG + Intronic
990556547 5:56942198-56942220 GATGAGCTCACCCACGGAGAGGG + Intronic
991110704 5:62896455-62896477 GGTGATCTGTCCCAGGGAGATGG + Intergenic
996420676 5:123258753-123258775 GGTGATCTGTCCCAGGGAGATGG + Intergenic
999958432 5:156727263-156727285 GGTGATCAGACCCAGGGGGATGG + Intronic
1002441283 5:179265705-179265727 GGTGATGTGGCCCACGCGGAAGG - Intronic
1009795025 6:68455926-68455948 GGTGATCTGTCCCAGGGAGATGG + Intergenic
1012665344 6:101961726-101961748 GGTGAGCTCTCCCTAGGGGAAGG - Intronic
1013606538 6:111754334-111754356 GGGCACCTCTCCCACGGGGAAGG + Intronic
1013625624 6:111934583-111934605 GGTGCTCTCTCCCAGGGGGATGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019411527 7:908856-908878 GGCCACCTCGCCCACGGGGGTGG + Intronic
1019421433 7:953061-953083 GTTGCTGTGGCCCACGGGGAGGG - Intronic
1023697729 7:42865048-42865070 GGTGCTCTCTCCCAGGGAGACGG + Intergenic
1025739177 7:64182562-64182584 GGAGCCCTCGCCCACTGGGACGG + Intronic
1037719693 8:21431877-21431899 GGTGCTCTCTCCCAGGGAGATGG - Intergenic
1045548103 8:103146319-103146341 GGTGCTCTCACTCTCGGGGATGG - Intronic
1058265828 9:102897941-102897963 GGTGCTCTCTCCCAGGGAGATGG - Intergenic
1062230873 9:135480553-135480575 GGTGAGCGCGCCCTCGGGGAGGG + Intronic
1186929175 X:14369731-14369753 GGTGCTCTGTCCCAGGGGGATGG - Intergenic
1187281602 X:17861444-17861466 GGTGATCTCGCCCACGGGGAGGG + Intergenic
1187829402 X:23365621-23365643 AGTGATCCCACCCATGGGGAGGG + Intronic
1189702575 X:43727288-43727310 GGTGCTCTGGCCCAAGGAGATGG + Intronic
1189937801 X:46087644-46087666 GGTGCTCTCTCCCAGGGAGATGG - Intergenic
1191098934 X:56704548-56704570 GGTGCTCTCTCCCAGGGAGATGG + Intergenic
1192403737 X:70863078-70863100 GGTGCTCTCTCCCAGGGTGATGG - Intronic
1192703128 X:73497656-73497678 GGTGATCTGTCCCAGGGAGATGG + Intergenic
1192960674 X:76127237-76127259 GGAGGTCTCGCCCACTGGGGAGG - Intergenic
1194139897 X:90196481-90196503 GGTGCTCTCTCCCATGGAGATGG - Intergenic
1195810589 X:108824829-108824851 GGTGATCTGTCCCAGGGAGATGG + Intergenic
1195859580 X:109368746-109368768 GATGATCTGGCCCAAGTGGATGG - Intergenic
1197395556 X:125922950-125922972 GGTGCTCTCTCCCAGGGAGATGG + Intergenic
1200057791 X:153470677-153470699 GGAGATGTCGCCCAATGGGAAGG - Intronic