ID: 1187282540

View in Genome Browser
Species Human (GRCh38)
Location X:17868924-17868946
Sequence GACACTTTAGTGAATTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187282540_1187282544 15 Left 1187282540 X:17868924-17868946 CCAGCCCAATTCACTAAAGTGTC No data
Right 1187282544 X:17868962-17868984 TGTCCACATTTCTGTGCACATGG No data
1187282540_1187282547 26 Left 1187282540 X:17868924-17868946 CCAGCCCAATTCACTAAAGTGTC No data
Right 1187282547 X:17868973-17868995 CTGTGCACATGGGAGAGAGTTGG No data
1187282540_1187282545 16 Left 1187282540 X:17868924-17868946 CCAGCCCAATTCACTAAAGTGTC No data
Right 1187282545 X:17868963-17868985 GTCCACATTTCTGTGCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187282540 Original CRISPR GACACTTTAGTGAATTGGGC TGG (reversed) Intergenic
No off target data available for this crispr