ID: 1187282544

View in Genome Browser
Species Human (GRCh38)
Location X:17868962-17868984
Sequence TGTCCACATTTCTGTGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187282540_1187282544 15 Left 1187282540 X:17868924-17868946 CCAGCCCAATTCACTAAAGTGTC No data
Right 1187282544 X:17868962-17868984 TGTCCACATTTCTGTGCACATGG No data
1187282539_1187282544 16 Left 1187282539 X:17868923-17868945 CCCAGCCCAATTCACTAAAGTGT No data
Right 1187282544 X:17868962-17868984 TGTCCACATTTCTGTGCACATGG No data
1187282541_1187282544 11 Left 1187282541 X:17868928-17868950 CCCAATTCACTAAAGTGTCTCCA No data
Right 1187282544 X:17868962-17868984 TGTCCACATTTCTGTGCACATGG No data
1187282543_1187282544 -9 Left 1187282543 X:17868948-17868970 CCATCAATCTCTGATGTCCACAT No data
Right 1187282544 X:17868962-17868984 TGTCCACATTTCTGTGCACATGG No data
1187282542_1187282544 10 Left 1187282542 X:17868929-17868951 CCAATTCACTAAAGTGTCTCCAT No data
Right 1187282544 X:17868962-17868984 TGTCCACATTTCTGTGCACATGG No data
1187282538_1187282544 22 Left 1187282538 X:17868917-17868939 CCACAACCCAGCCCAATTCACTA No data
Right 1187282544 X:17868962-17868984 TGTCCACATTTCTGTGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187282544 Original CRISPR TGTCCACATTTCTGTGCACA TGG Intergenic
No off target data available for this crispr