ID: 1187284224

View in Genome Browser
Species Human (GRCh38)
Location X:17887355-17887377
Sequence GTATCATAATATAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187284222_1187284224 11 Left 1187284222 X:17887321-17887343 CCAGCTAAAGCAAAAGGTTTAAA No data
Right 1187284224 X:17887355-17887377 GTATCATAATATAAGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187284224 Original CRISPR GTATCATAATATAAGTGTCC AGG Intergenic
No off target data available for this crispr