ID: 1187284224 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:17887355-17887377 |
| Sequence | GTATCATAATATAAGTGTCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187284222_1187284224 | 11 | Left | 1187284222 | X:17887321-17887343 | CCAGCTAAAGCAAAAGGTTTAAA | No data | ||
| Right | 1187284224 | X:17887355-17887377 | GTATCATAATATAAGTGTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187284224 | Original CRISPR | GTATCATAATATAAGTGTCC AGG | Intergenic | ||
| No off target data available for this crispr | |||||