ID: 1187287008

View in Genome Browser
Species Human (GRCh38)
Location X:17915351-17915373
Sequence AATGCCCACTTAATGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187287008_1187287012 5 Left 1187287008 X:17915351-17915373 CCACAAAACATTAAGTGGGCATT No data
Right 1187287012 X:17915379-17915401 TAACCCTTTTTGATGGATAGGGG No data
1187287008_1187287010 3 Left 1187287008 X:17915351-17915373 CCACAAAACATTAAGTGGGCATT No data
Right 1187287010 X:17915377-17915399 ATTAACCCTTTTTGATGGATAGG No data
1187287008_1187287015 10 Left 1187287008 X:17915351-17915373 CCACAAAACATTAAGTGGGCATT No data
Right 1187287015 X:17915384-17915406 CTTTTTGATGGATAGGGGAAAGG No data
1187287008_1187287009 -2 Left 1187287008 X:17915351-17915373 CCACAAAACATTAAGTGGGCATT No data
Right 1187287009 X:17915372-17915394 TTATTATTAACCCTTTTTGATGG No data
1187287008_1187287011 4 Left 1187287008 X:17915351-17915373 CCACAAAACATTAAGTGGGCATT No data
Right 1187287011 X:17915378-17915400 TTAACCCTTTTTGATGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187287008 Original CRISPR AATGCCCACTTAATGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr