ID: 1187291732

View in Genome Browser
Species Human (GRCh38)
Location X:17961131-17961153
Sequence GACTGAAGATTTTAAGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187291732_1187291733 10 Left 1187291732 X:17961131-17961153 CCTTTTGCTTAAAATCTTCAGTC No data
Right 1187291733 X:17961164-17961186 GTTTGAAATCAAACGTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187291732 Original CRISPR GACTGAAGATTTTAAGCAAA AGG (reversed) Intergenic
No off target data available for this crispr