ID: 1187291733

View in Genome Browser
Species Human (GRCh38)
Location X:17961164-17961186
Sequence GTTTGAAATCAAACGTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187291732_1187291733 10 Left 1187291732 X:17961131-17961153 CCTTTTGCTTAAAATCTTCAGTC No data
Right 1187291733 X:17961164-17961186 GTTTGAAATCAAACGTCCCTTGG No data
1187291731_1187291733 11 Left 1187291731 X:17961130-17961152 CCCTTTTGCTTAAAATCTTCAGT No data
Right 1187291733 X:17961164-17961186 GTTTGAAATCAAACGTCCCTTGG No data
1187291729_1187291733 18 Left 1187291729 X:17961123-17961145 CCAGTTCCCCTTTTGCTTAAAAT No data
Right 1187291733 X:17961164-17961186 GTTTGAAATCAAACGTCCCTTGG No data
1187291730_1187291733 12 Left 1187291730 X:17961129-17961151 CCCCTTTTGCTTAAAATCTTCAG No data
Right 1187291733 X:17961164-17961186 GTTTGAAATCAAACGTCCCTTGG No data
1187291728_1187291733 22 Left 1187291728 X:17961119-17961141 CCAACCAGTTCCCCTTTTGCTTA No data
Right 1187291733 X:17961164-17961186 GTTTGAAATCAAACGTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187291733 Original CRISPR GTTTGAAATCAAACGTCCCT TGG Intergenic
No off target data available for this crispr