ID: 1187293823

View in Genome Browser
Species Human (GRCh38)
Location X:17979919-17979941
Sequence CAATGAAAACACATGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187293823_1187293827 16 Left 1187293823 X:17979919-17979941 CCTGCATCCATGTGTTTTCATTG No data
Right 1187293827 X:17979958-17979980 GAGTGAGAACATGCAGTGTTTGG 0: 4435
1: 11380
2: 17706
3: 10546
4: 8009

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187293823 Original CRISPR CAATGAAAACACATGGATGC AGG (reversed) Intergenic
No off target data available for this crispr