ID: 1187293823 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:17979919-17979941 |
| Sequence | CAATGAAAACACATGGATGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187293823_1187293827 | 16 | Left | 1187293823 | X:17979919-17979941 | CCTGCATCCATGTGTTTTCATTG | No data | ||
| Right | 1187293827 | X:17979958-17979980 | GAGTGAGAACATGCAGTGTTTGG | 0: 4435 1: 11380 2: 17706 3: 10546 4: 8009 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187293823 | Original CRISPR | CAATGAAAACACATGGATGC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||