ID: 1187294681

View in Genome Browser
Species Human (GRCh38)
Location X:17987136-17987158
Sequence GCACTCACTTCTGGCACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187294679_1187294681 -7 Left 1187294679 X:17987120-17987142 CCACTGTGCTGGTCACGCACTCA No data
Right 1187294681 X:17987136-17987158 GCACTCACTTCTGGCACAGATGG No data
1187294673_1187294681 21 Left 1187294673 X:17987092-17987114 CCACCCCCAGGAGAGACTGAGAA No data
Right 1187294681 X:17987136-17987158 GCACTCACTTCTGGCACAGATGG No data
1187294676_1187294681 16 Left 1187294676 X:17987097-17987119 CCCAGGAGAGACTGAGAAAAGCA No data
Right 1187294681 X:17987136-17987158 GCACTCACTTCTGGCACAGATGG No data
1187294675_1187294681 17 Left 1187294675 X:17987096-17987118 CCCCAGGAGAGACTGAGAAAAGC No data
Right 1187294681 X:17987136-17987158 GCACTCACTTCTGGCACAGATGG No data
1187294674_1187294681 18 Left 1187294674 X:17987095-17987117 CCCCCAGGAGAGACTGAGAAAAG No data
Right 1187294681 X:17987136-17987158 GCACTCACTTCTGGCACAGATGG No data
1187294677_1187294681 15 Left 1187294677 X:17987098-17987120 CCAGGAGAGACTGAGAAAAGCAC No data
Right 1187294681 X:17987136-17987158 GCACTCACTTCTGGCACAGATGG No data
1187294672_1187294681 22 Left 1187294672 X:17987091-17987113 CCCACCCCCAGGAGAGACTGAGA No data
Right 1187294681 X:17987136-17987158 GCACTCACTTCTGGCACAGATGG No data
1187294671_1187294681 27 Left 1187294671 X:17987086-17987108 CCAAACCCACCCCCAGGAGAGAC No data
Right 1187294681 X:17987136-17987158 GCACTCACTTCTGGCACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187294681 Original CRISPR GCACTCACTTCTGGCACAGA TGG Intergenic
No off target data available for this crispr