ID: 1187296384

View in Genome Browser
Species Human (GRCh38)
Location X:18005297-18005319
Sequence ATGCAGCCACAGATTAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187296378_1187296384 30 Left 1187296378 X:18005244-18005266 CCCAGAGGGTTGTGTCTCTGTAG No data
Right 1187296384 X:18005297-18005319 ATGCAGCCACAGATTAAGCATGG No data
1187296379_1187296384 29 Left 1187296379 X:18005245-18005267 CCAGAGGGTTGTGTCTCTGTAGG No data
Right 1187296384 X:18005297-18005319 ATGCAGCCACAGATTAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187296384 Original CRISPR ATGCAGCCACAGATTAAGCA TGG Intergenic
No off target data available for this crispr