ID: 1187297034

View in Genome Browser
Species Human (GRCh38)
Location X:18012078-18012100
Sequence GGGTCCAGCAGACCAATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187297029_1187297034 6 Left 1187297029 X:18012049-18012071 CCCTGGACATTTTGTGCTCTTTG No data
Right 1187297034 X:18012078-18012100 GGGTCCAGCAGACCAATAGAGGG No data
1187297030_1187297034 5 Left 1187297030 X:18012050-18012072 CCTGGACATTTTGTGCTCTTTGT No data
Right 1187297034 X:18012078-18012100 GGGTCCAGCAGACCAATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187297034 Original CRISPR GGGTCCAGCAGACCAATAGA GGG Intergenic
No off target data available for this crispr