ID: 1187298545

View in Genome Browser
Species Human (GRCh38)
Location X:18026311-18026333
Sequence AGAGCCGCACCCTCTCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187298538_1187298545 -3 Left 1187298538 X:18026291-18026313 CCCCAAATGATGAATAGCCAAGA No data
Right 1187298545 X:18026311-18026333 AGAGCCGCACCCTCTCGGGGAGG No data
1187298537_1187298545 1 Left 1187298537 X:18026287-18026309 CCTGCCCCAAATGATGAATAGCC No data
Right 1187298545 X:18026311-18026333 AGAGCCGCACCCTCTCGGGGAGG No data
1187298540_1187298545 -5 Left 1187298540 X:18026293-18026315 CCAAATGATGAATAGCCAAGAGC No data
Right 1187298545 X:18026311-18026333 AGAGCCGCACCCTCTCGGGGAGG No data
1187298536_1187298545 9 Left 1187298536 X:18026279-18026301 CCATGGAGCCTGCCCCAAATGAT No data
Right 1187298545 X:18026311-18026333 AGAGCCGCACCCTCTCGGGGAGG No data
1187298539_1187298545 -4 Left 1187298539 X:18026292-18026314 CCCAAATGATGAATAGCCAAGAG No data
Right 1187298545 X:18026311-18026333 AGAGCCGCACCCTCTCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187298545 Original CRISPR AGAGCCGCACCCTCTCGGGG AGG Intergenic
No off target data available for this crispr