ID: 1187307846

View in Genome Browser
Species Human (GRCh38)
Location X:18113043-18113065
Sequence GTTGGCCAAGTCTCCATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187307840_1187307846 30 Left 1187307840 X:18112990-18113012 CCCTAGGGTGTAAAAACCTCCAA No data
Right 1187307846 X:18113043-18113065 GTTGGCCAAGTCTCCATTAATGG No data
1187307842_1187307846 14 Left 1187307842 X:18113006-18113028 CCTCCAAGACGCTAAATGACATT No data
Right 1187307846 X:18113043-18113065 GTTGGCCAAGTCTCCATTAATGG No data
1187307841_1187307846 29 Left 1187307841 X:18112991-18113013 CCTAGGGTGTAAAAACCTCCAAG No data
Right 1187307846 X:18113043-18113065 GTTGGCCAAGTCTCCATTAATGG No data
1187307843_1187307846 11 Left 1187307843 X:18113009-18113031 CCAAGACGCTAAATGACATTTTC No data
Right 1187307846 X:18113043-18113065 GTTGGCCAAGTCTCCATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187307846 Original CRISPR GTTGGCCAAGTCTCCATTAA TGG Intergenic
No off target data available for this crispr