ID: 1187307872 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:18113513-18113535 |
Sequence | GTTTCAACTCTGTAAGTGTG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1187307869_1187307872 | 17 | Left | 1187307869 | X:18113473-18113495 | CCTTTGGAACCACAGTATTTAAA | No data | ||
Right | 1187307872 | X:18113513-18113535 | GTTTCAACTCTGTAAGTGTGAGG | No data | ||||
1187307870_1187307872 | 8 | Left | 1187307870 | X:18113482-18113504 | CCACAGTATTTAAACTTATAAAG | No data | ||
Right | 1187307872 | X:18113513-18113535 | GTTTCAACTCTGTAAGTGTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1187307872 | Original CRISPR | GTTTCAACTCTGTAAGTGTG AGG | Intergenic | ||
No off target data available for this crispr |