ID: 1187307872

View in Genome Browser
Species Human (GRCh38)
Location X:18113513-18113535
Sequence GTTTCAACTCTGTAAGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187307869_1187307872 17 Left 1187307869 X:18113473-18113495 CCTTTGGAACCACAGTATTTAAA No data
Right 1187307872 X:18113513-18113535 GTTTCAACTCTGTAAGTGTGAGG No data
1187307870_1187307872 8 Left 1187307870 X:18113482-18113504 CCACAGTATTTAAACTTATAAAG No data
Right 1187307872 X:18113513-18113535 GTTTCAACTCTGTAAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187307872 Original CRISPR GTTTCAACTCTGTAAGTGTG AGG Intergenic
No off target data available for this crispr