ID: 1187308479

View in Genome Browser
Species Human (GRCh38)
Location X:18118699-18118721
Sequence CAGGGCAAGCCAGCAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187308471_1187308479 18 Left 1187308471 X:18118658-18118680 CCTAAGACTTTATCTGGCCACAG No data
Right 1187308479 X:18118699-18118721 CAGGGCAAGCCAGCAGTGGTGGG No data
1187308473_1187308479 1 Left 1187308473 X:18118675-18118697 CCACAGTAGCATTCTCGGTCCAT No data
Right 1187308479 X:18118699-18118721 CAGGGCAAGCCAGCAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187308479 Original CRISPR CAGGGCAAGCCAGCAGTGGT GGG Intergenic
No off target data available for this crispr