ID: 1187310049

View in Genome Browser
Species Human (GRCh38)
Location X:18133185-18133207
Sequence AGCCCCTTGATTTAAAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187310044_1187310049 12 Left 1187310044 X:18133150-18133172 CCATCACTTCTAGTCAGTGCCTG No data
Right 1187310049 X:18133185-18133207 AGCCCCTTGATTTAAAGTGGAGG No data
1187310046_1187310049 -7 Left 1187310046 X:18133169-18133191 CCTGGAATGCCACTAGAGCCCCT No data
Right 1187310049 X:18133185-18133207 AGCCCCTTGATTTAAAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187310049 Original CRISPR AGCCCCTTGATTTAAAGTGG AGG Intergenic
No off target data available for this crispr