ID: 1187310109

View in Genome Browser
Species Human (GRCh38)
Location X:18133674-18133696
Sequence GAGGTTAGCAAACTTGTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187310106_1187310109 10 Left 1187310106 X:18133641-18133663 CCAAGGTCACACAGTTAGAAATT No data
Right 1187310109 X:18133674-18133696 GAGGTTAGCAAACTTGTCCGTGG No data
1187310105_1187310109 11 Left 1187310105 X:18133640-18133662 CCCAAGGTCACACAGTTAGAAAT No data
Right 1187310109 X:18133674-18133696 GAGGTTAGCAAACTTGTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187310109 Original CRISPR GAGGTTAGCAAACTTGTCCG TGG Intergenic
No off target data available for this crispr