ID: 1187313641

View in Genome Browser
Species Human (GRCh38)
Location X:18171057-18171079
Sequence CTGGTCCAAAGTAACGTCTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187313641_1187313645 23 Left 1187313641 X:18171057-18171079 CCATAGACGTTACTTTGGACCAG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1187313645 X:18171103-18171125 GAATAAGGTATCTAGCCGACAGG 0: 1
1: 0
2: 0
3: 0
4: 30
1187313641_1187313644 8 Left 1187313641 X:18171057-18171079 CCATAGACGTTACTTTGGACCAG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1187313644 X:18171088-18171110 TTGTGAAGAGTTTCTGAATAAGG 0: 1
1: 0
2: 1
3: 19
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187313641 Original CRISPR CTGGTCCAAAGTAACGTCTA TGG (reversed) Exonic
907713236 1:56903958-56903980 CTGGTCCAAAGTTAAGCCTAAGG + Intronic
915932232 1:160067936-160067958 CTGGTCCCAAGGAAGGTCAAGGG + Intronic
1066196693 10:33106956-33106978 CTGGTCCACAGCAGCCTCTAGGG - Intergenic
1066627722 10:37426453-37426475 CTGGTAGAAAGTAATGTTTAGGG + Intergenic
1069647060 10:70008082-70008104 CTGGTAAAAAGTAAGGTCTGGGG - Intergenic
1075019750 10:118943288-118943310 CTGGTCCAAAGTAAAGTAAGGGG + Intergenic
1075106212 10:119541984-119542006 CTGGCCCAAAGTGACGGCCAAGG + Intronic
1083044149 11:59717544-59717566 ATGGTCTAAATTAACATCTAAGG - Intronic
1086801269 11:91179332-91179354 CTGGTAGAAAGTAACATCTAGGG - Intergenic
1089005235 11:115085216-115085238 CTGGCCCAAAGTTAAGTCCATGG - Intergenic
1098243453 12:68491160-68491182 CTGGTCCAAAATCACAACTAGGG - Intergenic
1102614484 12:114141429-114141451 CAGATCCAAAGTTACATCTATGG - Intergenic
1108148090 13:47500951-47500973 CTGCTCCAAAGTCAAGTCTTGGG + Intergenic
1115551953 14:34512652-34512674 CTGGTCCAAAGTGATGTTTATGG + Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1127399469 15:58572136-58572158 CTGGACCAAAGTAAAGTCAGAGG + Intergenic
1134228195 16:12408432-12408454 CTGGTCCACAATAACTTCTGTGG + Intronic
1138847153 16:60580223-60580245 TTGGTCCAAATTAAAGTGTAAGG - Intergenic
1153111973 18:1601687-1601709 CTAGTCCAAACTAACATATAGGG - Intergenic
1158154449 18:54409556-54409578 ATTGTCCAAAGTAATGTGTAAGG + Intergenic
1160218231 18:76952921-76952943 CTGGTCCAAAGTAAGCACTCAGG + Intronic
1160631535 18:80249815-80249837 CTGGTCCAGAGCCAAGTCTAGGG - Intergenic
938905320 2:135831140-135831162 CTGGTCTAAAGCAATGGCTAAGG + Intronic
941720541 2:168807916-168807938 CTGGACCAAAGCACAGTCTATGG - Intronic
1175408452 20:58750664-58750686 CTGGGGCAGAGTCACGTCTAAGG + Intergenic
956923614 3:73957733-73957755 CTGGTCAAGAGAAAAGTCTACGG + Intergenic
960992089 3:123318546-123318568 CTTGTCCAAAGTCACATCTGAGG + Intronic
963193175 3:142496348-142496370 CTGGTCCAAGGTAATGGCCAGGG - Exonic
966504990 3:180690456-180690478 CTGGTCCAAAATTATTTCTAGGG - Intronic
978232915 4:106422826-106422848 TTGGTCCAAAATAACGTCAGTGG - Intergenic
985564838 5:610322-610344 CTGGACCAATGGAACGTCTTGGG + Intergenic
985674561 5:1224386-1224408 CTGGACAACAGTAACTTCTAGGG - Exonic
991156322 5:63440651-63440673 CTGGTCCCCAGTAAAGTCTTTGG + Intergenic
993482938 5:88447673-88447695 CTGGTCCAGGGTAAGGTCTGTGG - Intergenic
1002137578 5:177117301-177117323 CTGGTCCAAAGTAGTGTTTTAGG + Intergenic
1007792198 6:44316735-44316757 CTGGTCCACATTAACCTCCACGG - Intronic
1015839848 6:137465645-137465667 CTGCTCCACAGTAGCATCTAGGG + Intergenic
1023114901 7:36853199-36853221 CAGGTCCAAAGGAGGGTCTAGGG + Intergenic
1023232311 7:38047663-38047685 TTGGTCCAAAGTACCTTTTAAGG + Intergenic
1032133421 7:129250925-129250947 CTTGTCCATATTAAAGTCTAGGG + Intronic
1039463302 8:37763509-37763531 CTTGTTCAAGGTAACGTCTAAGG - Intronic
1046607088 8:116383170-116383192 CTGGTCCAAAGCAGAGTTTAAGG + Intergenic
1052459783 9:28747557-28747579 CGGCTCCACAGTAATGTCTAGGG - Intergenic
1053242533 9:36507749-36507771 CTGATGCAAAGTAAAGCCTATGG + Intergenic
1053246134 9:36536060-36536082 ATGGTCCAAAGTCTCGTCTGAGG - Intergenic
1062703491 9:137920592-137920614 CTTGTCCAAATTATCATCTAGGG + Intronic
1187313641 X:18171057-18171079 CTGGTCCAAAGTAACGTCTATGG - Exonic
1193251731 X:79298897-79298919 CTGGTCCAAGCTAACTTCCAGGG + Intergenic
1195934886 X:110115502-110115524 CTGGTCCAAACCAAATTCTAGGG + Intronic
1198653506 X:138889370-138889392 CTGGTCCAAATTCCCATCTAAGG - Intronic