ID: 1187318527

View in Genome Browser
Species Human (GRCh38)
Location X:18220375-18220397
Sequence CGAGAGTGCGTCAAGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187318527_1187318537 22 Left 1187318527 X:18220375-18220397 CCCAGCCTCTTGACGCACTCTCG No data
Right 1187318537 X:18220420-18220442 CCCTGAGCCACCAAGAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187318527 Original CRISPR CGAGAGTGCGTCAAGAGGCT GGG (reversed) Intronic