ID: 1187318530 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:18220380-18220402 |
| Sequence | TGTGCCGAGAGTGCGTCAAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187318530_1187318537 | 17 | Left | 1187318530 | X:18220380-18220402 | CCTCTTGACGCACTCTCGGCACA | No data | ||
| Right | 1187318537 | X:18220420-18220442 | CCCTGAGCCACCAAGAGCCACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187318530 | Original CRISPR | TGTGCCGAGAGTGCGTCAAG AGG (reversed) | Intronic | ||