ID: 1187318533

View in Genome Browser
Species Human (GRCh38)
Location X:18220414-18220436
Sequence CTCTTGGTGGCTCAGGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187318533_1187318545 20 Left 1187318533 X:18220414-18220436 CCCCAACCCTGAGCCACCAAGAG No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data
1187318533_1187318542 2 Left 1187318533 X:18220414-18220436 CCCCAACCCTGAGCCACCAAGAG No data
Right 1187318542 X:18220439-18220461 ACGGAGACGCCATGAGCCTCAGG No data
1187318533_1187318546 21 Left 1187318533 X:18220414-18220436 CCCCAACCCTGAGCCACCAAGAG No data
Right 1187318546 X:18220458-18220480 CAGGATCACCTCACGTCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187318533 Original CRISPR CTCTTGGTGGCTCAGGGTTG GGG (reversed) Intronic