ID: 1187318537

View in Genome Browser
Species Human (GRCh38)
Location X:18220420-18220442
Sequence CCCTGAGCCACCAAGAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187318531_1187318537 -8 Left 1187318531 X:18220405-18220427 CCCAAGTCACCCCAACCCTGAGC No data
Right 1187318537 X:18220420-18220442 CCCTGAGCCACCAAGAGCCACGG No data
1187318527_1187318537 22 Left 1187318527 X:18220375-18220397 CCCAGCCTCTTGACGCACTCTCG No data
Right 1187318537 X:18220420-18220442 CCCTGAGCCACCAAGAGCCACGG No data
1187318528_1187318537 21 Left 1187318528 X:18220376-18220398 CCAGCCTCTTGACGCACTCTCGG No data
Right 1187318537 X:18220420-18220442 CCCTGAGCCACCAAGAGCCACGG No data
1187318532_1187318537 -9 Left 1187318532 X:18220406-18220428 CCAAGTCACCCCAACCCTGAGCC No data
Right 1187318537 X:18220420-18220442 CCCTGAGCCACCAAGAGCCACGG No data
1187318530_1187318537 17 Left 1187318530 X:18220380-18220402 CCTCTTGACGCACTCTCGGCACA No data
Right 1187318537 X:18220420-18220442 CCCTGAGCCACCAAGAGCCACGG No data
1187318526_1187318537 27 Left 1187318526 X:18220370-18220392 CCAGGCCCAGCCTCTTGACGCAC No data
Right 1187318537 X:18220420-18220442 CCCTGAGCCACCAAGAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187318537 Original CRISPR CCCTGAGCCACCAAGAGCCA CGG Intronic