ID: 1187318538

View in Genome Browser
Species Human (GRCh38)
Location X:18220421-18220443
Sequence TCCGTGGCTCTTGGTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187318538_1187318546 14 Left 1187318538 X:18220421-18220443 CCTGAGCCACCAAGAGCCACGGA No data
Right 1187318546 X:18220458-18220480 CAGGATCACCTCACGTCTCCGGG No data
1187318538_1187318545 13 Left 1187318538 X:18220421-18220443 CCTGAGCCACCAAGAGCCACGGA No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data
1187318538_1187318542 -5 Left 1187318538 X:18220421-18220443 CCTGAGCCACCAAGAGCCACGGA No data
Right 1187318542 X:18220439-18220461 ACGGAGACGCCATGAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187318538 Original CRISPR TCCGTGGCTCTTGGTGGCTC AGG (reversed) Intronic