ID: 1187318539 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:18220427-18220449 |
| Sequence | GGCGTCTCCGTGGCTCTTGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187318539_1187318546 | 8 | Left | 1187318539 | X:18220427-18220449 | CCACCAAGAGCCACGGAGACGCC | No data | ||
| Right | 1187318546 | X:18220458-18220480 | CAGGATCACCTCACGTCTCCGGG | No data | ||||
| 1187318539_1187318545 | 7 | Left | 1187318539 | X:18220427-18220449 | CCACCAAGAGCCACGGAGACGCC | No data | ||
| Right | 1187318545 | X:18220457-18220479 | TCAGGATCACCTCACGTCTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187318539 | Original CRISPR | GGCGTCTCCGTGGCTCTTGG TGG (reversed) | Intronic | ||