ID: 1187318541

View in Genome Browser
Species Human (GRCh38)
Location X:18220437-18220459
Sequence TGAGGCTCATGGCGTCTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187318541_1187318546 -2 Left 1187318541 X:18220437-18220459 CCACGGAGACGCCATGAGCCTCA No data
Right 1187318546 X:18220458-18220480 CAGGATCACCTCACGTCTCCGGG No data
1187318541_1187318545 -3 Left 1187318541 X:18220437-18220459 CCACGGAGACGCCATGAGCCTCA No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187318541 Original CRISPR TGAGGCTCATGGCGTCTCCG TGG (reversed) Intronic