ID: 1187318545

View in Genome Browser
Species Human (GRCh38)
Location X:18220457-18220479
Sequence TCAGGATCACCTCACGTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187318538_1187318545 13 Left 1187318538 X:18220421-18220443 CCTGAGCCACCAAGAGCCACGGA No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data
1187318531_1187318545 29 Left 1187318531 X:18220405-18220427 CCCAAGTCACCCCAACCCTGAGC No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data
1187318532_1187318545 28 Left 1187318532 X:18220406-18220428 CCAAGTCACCCCAACCCTGAGCC No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data
1187318533_1187318545 20 Left 1187318533 X:18220414-18220436 CCCCAACCCTGAGCCACCAAGAG No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data
1187318541_1187318545 -3 Left 1187318541 X:18220437-18220459 CCACGGAGACGCCATGAGCCTCA No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data
1187318535_1187318545 18 Left 1187318535 X:18220416-18220438 CCAACCCTGAGCCACCAAGAGCC No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data
1187318540_1187318545 4 Left 1187318540 X:18220430-18220452 CCAAGAGCCACGGAGACGCCATG No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data
1187318539_1187318545 7 Left 1187318539 X:18220427-18220449 CCACCAAGAGCCACGGAGACGCC No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data
1187318536_1187318545 14 Left 1187318536 X:18220420-18220442 CCCTGAGCCACCAAGAGCCACGG No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data
1187318534_1187318545 19 Left 1187318534 X:18220415-18220437 CCCAACCCTGAGCCACCAAGAGC No data
Right 1187318545 X:18220457-18220479 TCAGGATCACCTCACGTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187318545 Original CRISPR TCAGGATCACCTCACGTCTC CGG Intronic