ID: 1187320908

View in Genome Browser
Species Human (GRCh38)
Location X:18236904-18236926
Sequence CTGAATCTTCAGAATGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187320905_1187320908 7 Left 1187320905 X:18236874-18236896 CCAGGTCTGGTCAGGGACATATG No data
Right 1187320908 X:18236904-18236926 CTGAATCTTCAGAATGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187320908 Original CRISPR CTGAATCTTCAGAATGGAAG TGG Intergenic
No off target data available for this crispr