ID: 1187328291

View in Genome Browser
Species Human (GRCh38)
Location X:18312326-18312348
Sequence ATCAGGGACTTGAGTGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 836
Summary {0: 2, 1: 3, 2: 41, 3: 233, 4: 557}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187328291 Original CRISPR ATCAGGGACTTGAGTGTCCT TGG (reversed) Intronic
900327055 1:2113546-2113568 ACCAGGGCCTTGAGTGAGCTGGG + Intronic
900785049 1:4644275-4644297 TTCACGGACCTGTGTGTCCTGGG + Intergenic
901810456 1:11764375-11764397 CTCAGGGACAGGAGTATCCTTGG - Exonic
901821182 1:11830549-11830571 ATCTGGGACTTGAGCATCCCTGG + Intronic
901907593 1:12427680-12427702 ATCAGGGACTTCAGCGTCTGTGG + Intronic
901911149 1:12459357-12459379 GTAAGGGACTTGAGCATCCTAGG + Intronic
902050353 1:13559450-13559472 ACCAGGGACTTGAGGATCCAAGG + Intergenic
902720009 1:18297637-18297659 ATGTGGGACTTGAGAATCCTAGG - Intronic
903110265 1:21126818-21126840 ATCAGGGAATTGAGCATCTTTGG - Intronic
903308608 1:22433590-22433612 ATCAGGGACTTGAGCATCCATGG + Intergenic
903841001 1:26240369-26240391 ATCAGGGACTTGAGTATCTGTGG - Intronic
903940758 1:26929560-26929582 ATAAGGGACTTGAGCATCCTCGG + Intronic
903966966 1:27096782-27096804 ATAAGGGACTTGAGCTTCCTTGG - Intergenic
904790416 1:33016136-33016158 ATCAGGGACTTGAGCATCTATGG - Intronic
905185171 1:36191022-36191044 ATCAGAGACTTGAGCATCCAAGG - Intergenic
905202838 1:36325451-36325473 ATCAAGGACTTGAGGATCCTTGG + Intronic
905210508 1:36370805-36370827 ATTAGGGACTTGAGCACCCTTGG - Intronic
905476389 1:38231489-38231511 TTCAGGGAGTTCAGTCTCCTGGG - Intergenic
905741842 1:40377897-40377919 ATCAGGGACTTGAGCATCTGTGG - Intronic
905793630 1:40803171-40803193 CTCAGGGACTTCTGTGTTCTGGG - Intronic
906011426 1:42530785-42530807 ATGAGGGACTTGAGCATCCATGG + Intronic
906820516 1:48925250-48925272 ATAAAGGACTTGAGTGTCCATGG - Intronic
906975236 1:50563095-50563117 ATCAGGGACTTGAGTATCTGTGG + Intronic
907094112 1:51760159-51760181 ATCAGGGACTTGAGTGTCTGTGG + Intronic
907167013 1:52421679-52421701 ATCAGGGACCTGAGCATCCTTGG - Intronic
907967268 1:59344628-59344650 ATCAGGGACTTGAGTATCTGTGG - Intronic
908272256 1:62433486-62433508 ATATGGGACTTGAGCATCCTCGG + Intergenic
908410041 1:63854823-63854845 ATCAGAGACTTGAGCATCCAAGG - Intronic
908420564 1:63954804-63954826 GTCAGGGACTTGATCATCCTTGG + Intronic
908812156 1:67993014-67993036 ATAAGGGACTTGAGTATCCATGG - Intergenic
909067501 1:70953265-70953287 ATAAGGGATTTGAGCATCCTGGG + Intronic
909112004 1:71491294-71491316 ATCAGGGACTTGAGCATCTTTGG + Intronic
909687208 1:78363384-78363406 ATCAGGAACTTGAGCAACCTTGG - Intronic
910130863 1:83903512-83903534 ATCATGGACTTGAGCATCCATGG - Intronic
910189125 1:84576682-84576704 ATAAGGGACTTGAGCATCCATGG + Intergenic
911028012 1:93455508-93455530 ATAAGGGACTTGAGCATCCATGG + Intronic
911139734 1:94486255-94486277 ATCAGGGACTTGAGCATCCATGG + Intronic
911709424 1:101053137-101053159 ATCAGGGACTTGAGCTTCCTTGG - Intergenic
911804151 1:102184473-102184495 ATAAGGGACTTGAGCATCCATGG + Intergenic
913050248 1:115111178-115111200 ATAAGGGACTTGAGCATCCGTGG - Intergenic
914253221 1:145939213-145939235 ATGAAGGACTTGAGCATCCTTGG + Intronic
916869360 1:168895757-168895779 TCCAGGGATTTCAGTGTCCTGGG + Intergenic
917169725 1:172157806-172157828 ATAAGGGACTTGAGTATCTTTGG + Intronic
918031000 1:180810899-180810921 ATAAGGGACTTGAGCATCCACGG - Intronic
918252512 1:182715976-182715998 ATGAGGGACTTGAATATCCATGG - Intergenic
918402783 1:184180466-184180488 ATAAGGGACTTGAGCATCCATGG + Intergenic
918490339 1:185074876-185074898 ATAAGGGACTTGAGTATCCATGG + Intronic
918491818 1:185089383-185089405 ATAAGGGACTTGAGCATCCAAGG + Intronic
918525828 1:185463781-185463803 ATGAGGGACTTGAGTATCTGTGG - Intergenic
918783955 1:188740155-188740177 ATCAGAGACTTGAGCATCCATGG + Intergenic
918960985 1:191277498-191277520 ATAAGGGACTTGAGCATGCTTGG - Intergenic
919048931 1:192488311-192488333 ATCAGGGGCTTTATTTTCCTTGG + Intergenic
920079477 1:203361921-203361943 ATCCGGGAATTGAGTGGGCTTGG + Intergenic
920364865 1:205442861-205442883 ATCTGGGACTTAGGTGGCCTGGG + Intronic
920861586 1:209712543-209712565 ATGAGGGACTTGAGTATCTATGG + Intronic
920866555 1:209758380-209758402 GTCAGGCATTTGAGTGTCCAGGG + Intronic
921186046 1:212670409-212670431 GTCAGGGACTTGAGCGTCTTTGG + Intergenic
921266280 1:213423405-213423427 CTCTGGGACTTGAGTTTCTTAGG - Intergenic
921582693 1:216913347-216913369 ATCAGGGACTTGAGTATTCATGG + Intronic
921998274 1:221445687-221445709 GTCAGAGACTTGACTGTCCTTGG - Intergenic
922224975 1:223638274-223638296 ATCAGGGACTTGAGCATCTGTGG + Intronic
922328719 1:224555003-224555025 ATCAGGGACTTGAGCATCCGTGG + Intronic
922384070 1:225063229-225063251 ATAAGGGACTTGAGTATCTATGG - Intronic
922908881 1:229198894-229198916 AACAGGGACTTGAGCATCCATGG + Intergenic
922998231 1:229983970-229983992 ATCAGGGACTTGAGCTTCCATGG + Intergenic
923031732 1:230254471-230254493 ATCAGTTACTTGACTGTCCTTGG + Intronic
923162596 1:231329487-231329509 ACCAGGGACTTGAGCGTCTGTGG + Intergenic
923305903 1:232687943-232687965 ATAAGGGACTTGAGTGTCTGTGG + Intergenic
923633050 1:235667595-235667617 ATCAAGGACTTGAGCATCCATGG - Intronic
924092095 1:240511767-240511789 AAAAGGGACTTGAGCGTCCGTGG + Intronic
924405568 1:243742128-243742150 ATAAGGGACTTGAGCATCCTTGG + Intronic
1062995857 10:1866185-1866207 ATAAGGGACTTGAGCATCCGAGG + Intergenic
1063121845 10:3110013-3110035 ATCACAGACCTGAATGTCCTTGG - Intronic
1063437592 10:6047107-6047129 TGCAGGGATTTGAGGGTCCTTGG - Intronic
1065541552 10:26774065-26774087 ATGAGGGATTTGAGCATCCTTGG - Intronic
1065818664 10:29505916-29505938 ATCAGGGACTTGAGCATCTGTGG - Intronic
1066178304 10:32934426-32934448 ATCAGGGACTTGAGTATTTGTGG + Intronic
1066255097 10:33670796-33670818 ATCAGGGACTTGAGCATCTGTGG - Intergenic
1067711128 10:48651996-48652018 AACAGAGACTTCAGGGTCCTGGG - Intronic
1067830197 10:49607312-49607334 ATGAGGGAGTTTAGTGTCTTTGG + Intergenic
1067938194 10:50629143-50629165 ATCAGGGACTTGAGCATCTGAGG - Intergenic
1068033814 10:51735601-51735623 ATCAGGGACTTGAGTGGATTTGG - Intronic
1068073691 10:52227573-52227595 ATCAGGGACTTGAGGATCTGTGG + Intronic
1068700771 10:60017432-60017454 ATCAGGGACTTGAGCATCTGTGG + Intergenic
1068721813 10:60254052-60254074 ATAAGGGACTTGAGCATCCATGG - Intronic
1069012098 10:63385846-63385868 ATCAGGATCTGGAGTATCCTGGG - Intronic
1069650815 10:70046799-70046821 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1070209800 10:74304988-74305010 ATCAGGGACTTGAGAATCCTTGG - Intronic
1070212225 10:74336714-74336736 TTAAGGGACTTGAGTATCCATGG - Intronic
1070271025 10:74955057-74955079 ATAAGGGACTTGAGCATCCATGG - Intronic
1070673116 10:78392163-78392185 ACCAGGGACTTGAGCATCCCTGG + Intergenic
1071035899 10:81245195-81245217 ATAAGGAACTTGAAAGTCCTTGG - Intergenic
1071198530 10:83190643-83190665 ATCAGGGTCTTGAGTGGCTATGG - Intergenic
1072666491 10:97396697-97396719 ATAAGGGACCTGAGCATCCTCGG - Intronic
1072977501 10:100071849-100071871 ATAAGGGACTTGAGCATCCAAGG + Intronic
1073185871 10:101614720-101614742 AACAGAGCCTTGAGGGTCCTGGG - Intronic
1073438243 10:103535480-103535502 ATAGGGGACATGACTGTCCTCGG + Intronic
1074131334 10:110580200-110580222 ATAAGGGACTTGAGCATCCTTGG + Intronic
1074354090 10:112766553-112766575 ATCAGGAACTAGATTCTCCTTGG + Intronic
1074744420 10:116517317-116517339 ATAAGGGACTTGAGTATCTGAGG - Intergenic
1074840009 10:117341533-117341555 ATTAGAGACTTGAGCATCCTGGG - Intronic
1074841924 10:117361954-117361976 ATCAGGGACTTGAGCATCTGTGG + Intronic
1075059567 10:119246173-119246195 ATCAGGGACTTGAGCATCCATGG - Intronic
1075063098 10:119270517-119270539 ATCAGGGACTTGAGCATCCATGG + Intronic
1075239622 10:120766112-120766134 ATCAGAGACTTGAGCATCCATGG + Intergenic
1077382183 11:2249329-2249351 ATCCGGGACGTGTGTGCCCTGGG + Intergenic
1077991563 11:7416711-7416733 ATAAGGGACCTGAGCATCCTTGG + Intronic
1078241255 11:9532584-9532606 ATCAGGGACTTGAGAATCCATGG + Intergenic
1078397853 11:10997495-10997517 ATCAGGGACTTGAGCATCTTTGG - Intergenic
1078709849 11:13780469-13780491 ATAAGGGACTTGAGCATCCATGG - Intergenic
1078928752 11:15897159-15897181 ATCAGGGACTTGATCATCCATGG + Intergenic
1079050244 11:17149421-17149443 ATCAGGGATTTGAGCATCCTGGG + Intronic
1079592775 11:22200981-22201003 ATAAGGGACTTGAGCATCCTTGG - Intronic
1080024773 11:27601599-27601621 ATAAAGGACTTGAGCATCCTAGG - Intergenic
1080067620 11:28037515-28037537 GTAAGGGACTTGAGTATCCATGG + Intronic
1080076188 11:28152654-28152676 ATAAGGAACTTGAGTATCTTCGG - Intronic
1080422260 11:32121051-32121073 ATCAGGCACTTGAGCGCCCTTGG + Intergenic
1080544562 11:33303157-33303179 ATAAGGGACTTGAGTGTCTGTGG - Intronic
1081630092 11:44683520-44683542 ATAAGGGACTTGAGTATCTGTGG - Intergenic
1081704426 11:45172788-45172810 ATCCAGGACTTGAGCATCCTTGG + Intronic
1082070486 11:47935760-47935782 TTCAGGGACTTGAGCATCCATGG + Intergenic
1082788894 11:57333590-57333612 AACACCGACTTGAATGTCCTGGG + Intronic
1082822803 11:57555975-57555997 CTCAGGGGCTGGAGTGACCTAGG + Intronic
1083661045 11:64251875-64251897 ATCGGGGACTTAAGTTTCCGGGG - Intronic
1084336032 11:68458331-68458353 ATATGGGACTTGAGAATCCTTGG - Intergenic
1084362827 11:68680025-68680047 ATAAGGGACTTGAGCATCCACGG - Intergenic
1084754059 11:71223591-71223613 ATCAGGGACTTGAGCATCCATGG + Intronic
1085231815 11:74978543-74978565 ATAAGGGACTTGAGCATCCTTGG - Exonic
1085373723 11:76038530-76038552 ATCAGGGGCTTGAGCTTACTTGG + Intronic
1086360865 11:86057857-86057879 ATCAGGGATTTGAGCACCCTTGG + Intronic
1086408798 11:86522925-86522947 ATCAGGGATTTGAGCATCCATGG + Intronic
1087660401 11:100981283-100981305 ATCAGAGGCTTGAGTGTCTTAGG - Intronic
1087778538 11:102278871-102278893 ATCAGGGACTTGAGCATCCTTGG + Intergenic
1088106804 11:106215935-106215957 GTCAGGGACTTAAGCTTCCTTGG + Intergenic
1088174221 11:107032750-107032772 ATAAGGGACTTGAGCCTCCATGG - Intergenic
1088685830 11:112283911-112283933 ATCAGGGACTTGAGCATCTGTGG - Intergenic
1088697272 11:112378796-112378818 ATTAGGTACTTGAGCATCCTTGG - Intergenic
1088837979 11:113594769-113594791 ATCAGGGACTTTAGCATCCATGG + Intergenic
1089421437 11:118333958-118333980 ATAAGGGACTTGAGCATCCATGG - Intergenic
1090110531 11:123903236-123903258 ATCAGGGACTTGAGCATTCAGGG + Intergenic
1090127573 11:124104088-124104110 ATAAGGGACATGAGTATACTTGG - Intergenic
1090250694 11:125249638-125249660 ATCACGGATTCGAGTGTCCATGG + Intronic
1090379235 11:126313701-126313723 ATCAGGGAGGTGATTATCCTTGG + Intronic
1091442020 12:518348-518370 ATAAGGGACCTGAGTATCCTCGG - Intronic
1091501806 12:1025037-1025059 ATCAGGGACTTGAGCATCCTGGG + Intronic
1091742420 12:2969367-2969389 ATGAGGGACTTGAGCATCCTCGG + Intronic
1091796885 12:3302512-3302534 ATCAGGGACTTGAGCATCAGTGG - Intergenic
1091869879 12:3880588-3880610 ATCAGGGACTTGAGCATCCCAGG + Intergenic
1092454239 12:8628122-8628144 ATAAAGGACTTGAGTGTCCTCGG + Intergenic
1092760693 12:11808614-11808636 ATAAGGGATTTGAGCATCCTTGG + Intronic
1092893339 12:12989969-12989991 ATCAGGGACTTGAGCATCCATGG - Intronic
1093557848 12:20498569-20498591 ATCAGGGACTTGAGCATCCCTGG + Intronic
1093785901 12:23191883-23191905 ATCAGGGACTTAAGCATCCCTGG - Intergenic
1094183783 12:27619192-27619214 ATCAGGGACTTGAGCATCTCTGG - Intronic
1095410251 12:41913493-41913515 ATTAGAGACTTGAGCATCCTTGG - Intergenic
1095797184 12:46232737-46232759 GTTAGGGACTTGAGCATCCTTGG - Intronic
1096173081 12:49489839-49489861 ATAAGGGACTTGATTGGACTTGG + Intronic
1096727113 12:53573329-53573351 ATCAGGGACTTGAGTATCTGTGG - Intronic
1097125848 12:56774282-56774304 ATAAGGGATTTGAGCATCCTCGG - Intronic
1097311197 12:58121438-58121460 ATCAGGGACTTGAGCACCCGTGG - Intergenic
1097681258 12:62651549-62651571 CTCAGGGAAATGAGTTTCCTGGG - Intronic
1097815955 12:64073528-64073550 ATAAGGGACTTGAGCATCTTCGG - Intronic
1098254014 12:68598314-68598336 ATAAGGGACTTGAGCATCCATGG + Intergenic
1099052024 12:77791942-77791964 ATCAGAGACTTGAGCATCCATGG + Intergenic
1099123385 12:78720716-78720738 ATAAGGGACTTAAGTATCCATGG + Intergenic
1099171449 12:79369398-79369420 ATCATGGGCTTGAGCCTCCTGGG - Intronic
1100111741 12:91253030-91253052 ATCAGAGACTTGATCATCCTTGG + Intergenic
1100130860 12:91491676-91491698 ATCAGGGACTTGTGGATCCATGG - Intergenic
1100342772 12:93696928-93696950 ATCAGGGACTTGAGCATCCATGG + Intronic
1100502906 12:95191666-95191688 ATAAGGGACTTGAGCATCCATGG - Intronic
1100506125 12:95222014-95222036 ATAAGGGACTTGAGCATCCATGG + Intronic
1101366877 12:104080289-104080311 ATCAGGGACTTGAGCATCCATGG - Intronic
1101454603 12:104816878-104816900 GTAAAGGACTTGAGTATCCTTGG - Intronic
1102270799 12:111533319-111533341 ATCAGGGACTTAAGCATCCCTGG - Intronic
1102582967 12:113903176-113903198 AGAAGGGACTTGAGCATCCTTGG - Intronic
1104307915 12:127626534-127626556 ATGAGGGACTTGAACATCCTTGG + Intergenic
1104450672 12:128866008-128866030 ATCTGGGACTTAAGCATCCTTGG + Intronic
1104466968 12:128998434-128998456 ATCAGGGACTGGAGTGCCTTTGG - Intergenic
1104871701 12:132003402-132003424 ATAAGGGACTTGAGCATCCTTGG + Intronic
1105548635 13:21370812-21370834 ATCAGGGACTTGAGCATCTGTGG + Intergenic
1106113046 13:26793646-26793668 CTCAGGGACTTGAGCATCCTTGG - Intergenic
1106167926 13:27265498-27265520 ATCAGGGACTTAAGCATCCCTGG + Intergenic
1106175955 13:27331888-27331910 ATCAGGGACTTGAGCATCCTTGG + Intergenic
1106232817 13:27834441-27834463 AGCAGGGACTTGAGCATCCATGG - Intergenic
1106261409 13:28070164-28070186 ATCAGGTACTTGAGTATCCATGG + Intronic
1106444183 13:29809788-29809810 ATCAGGAACCAGAGCGTCCTTGG - Intronic
1106796501 13:33211527-33211549 ATCAGGGACTTGAGAATCTGTGG - Intronic
1106912008 13:34472873-34472895 ATCAGGGACTTGAGTATCCATGG + Intergenic
1107132691 13:36912942-36912964 ACGAGGGACTTGAGCATCCTTGG - Intronic
1107710870 13:43149347-43149369 ATCAGGGACTTGAGCATCCATGG - Intergenic
1108220198 13:48225733-48225755 ATAAGGGACTTGAGCGTCTGTGG - Intergenic
1108349460 13:49578143-49578165 ATCAGGGACTTGAGCATCTGTGG - Intronic
1108432295 13:50366438-50366460 ATCATGAACTTGAGTCTCATGGG + Intronic
1108951834 13:56104158-56104180 ATCAGGGACTTGAGCATCCATGG - Intergenic
1110243303 13:73292768-73292790 ATCAGGGACTTGAGCATCTGTGG - Intergenic
1110272171 13:73603205-73603227 ATAAGGGACTTGAGCATCCATGG - Intergenic
1110348271 13:74475066-74475088 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1111393889 13:87637313-87637335 ATCAGGGACTTGAGCATCCGAGG + Intergenic
1112090184 13:96075041-96075063 ATCAGGGATTTGAATGTTCATGG - Intergenic
1112456000 13:99564564-99564586 ATCAAGGACTTGAGCATCCATGG - Intergenic
1112793870 13:103033032-103033054 ACAAGGGACTTTAGTATCCTTGG - Intergenic
1113491461 13:110695437-110695459 ATCAGGGACTCGAGCATCCAAGG + Intronic
1113562156 13:111290464-111290486 ATCAGGGACTGGAGCGTCTGAGG + Intronic
1113862865 13:113501435-113501457 ATCAGAGACTTGAGCATCCGAGG + Intronic
1113972442 13:114200238-114200260 TTCTGTGACTTGAGTGCCCTGGG - Intergenic
1114889999 14:26908098-26908120 ATCAGGGACTTGAGCATTCATGG - Intergenic
1115322654 14:32100639-32100661 ATAAGGGACTTCAGTGTCCTCGG + Intronic
1115637443 14:35304342-35304364 ATCAGAGACTTGAGTTTCTGTGG + Intronic
1116071490 14:40051816-40051838 TTCAGGGTCATGAGTGACCTTGG - Intergenic
1116966030 14:51016073-51016095 ATCAGGGACTTGAGCATCTGTGG - Intronic
1117056760 14:51920032-51920054 TACAGGGACTTGAGTATCCATGG - Intronic
1117369026 14:55058993-55059015 ATCAGGTACTTGAGCATCCTGGG + Intronic
1117393040 14:55280830-55280852 ATCAGGAACTTGAGCATCCATGG + Intronic
1117686638 14:58260174-58260196 ATCAGGGACTTCAGCAACCTTGG - Intronic
1117862415 14:60106231-60106253 ATCAGAGACTTGAACATCCTTGG - Intronic
1118308056 14:64672602-64672624 ATCAGAAACTTGAGTATCCGTGG + Intergenic
1118650576 14:67888804-67888826 ATGAGGGACTTGAGCATCCGTGG + Intronic
1119970966 14:78969934-78969956 ATCAGGGATTTTTGTCTCCTTGG + Intronic
1120210161 14:81626312-81626334 ATCAGTGACTTGAGCATCCATGG + Intergenic
1120417375 14:84236805-84236827 ATAAGGGGCTTGAGCATCCTTGG - Intergenic
1120425660 14:84344402-84344424 ATAAGGGACTTGAGCATCCGTGG - Intergenic
1120476123 14:84989889-84989911 ATCAGGGACTTGAGAATCTATGG + Intergenic
1121055017 14:90845305-90845327 GTCAGGGACTTGAGCATCCTCGG + Intergenic
1121140414 14:91536790-91536812 ATAAGGGACTTGAGCATCCATGG - Intergenic
1121166973 14:91811792-91811814 ATAAGGGACTTGAGCATCCATGG - Intronic
1121451965 14:94014284-94014306 ATCAGGGACTTGAGTATCTGAGG + Intergenic
1121460977 14:94078219-94078241 ATCAGAGACTTGAGCATCCCTGG + Intronic
1122377712 14:101277337-101277359 ATCATGGAATTGAGTTCCCTGGG + Intergenic
1122753071 14:103953740-103953762 ATCAGGAACTCTAGTGTCCCAGG + Intronic
1123983391 15:25623384-25623406 AGGAGGGACGAGAGTGTCCTTGG + Intergenic
1124094839 15:26639535-26639557 ATCAAGGACTTGAGCATCTTTGG + Intronic
1124270702 15:28277888-28277910 ATCAGGGACTTGAGCATCCTAGG - Intronic
1124579001 15:30935603-30935625 ATCAGGGACTTGAGCATCCATGG + Intronic
1124892865 15:33748847-33748869 ATCAGGGACTTGAGCGTTCGTGG - Intronic
1124939167 15:34202025-34202047 ATCAGGGATTTGAGCATCCTCGG + Intronic
1125020345 15:34978816-34978838 GTAAGGGACTTGAGTATACTTGG - Exonic
1125650520 15:41313799-41313821 ATCAGAAACTTGAGTGTCCATGG + Intronic
1125695875 15:41636864-41636886 ATCAGGGATTTGAGCATCCATGG + Intronic
1126069757 15:44855907-44855929 ACAAGGGACTTGAGAATCCTTGG + Intergenic
1126088772 15:45033255-45033277 ACAAGGGACTTGAGAATCCTTGG - Intronic
1126139195 15:45423496-45423518 ATCAGGGACTTGAGTATTCGTGG + Intergenic
1127013308 15:54654183-54654205 AACAGTGACTTGAGTGTACAAGG - Intergenic
1127257201 15:57302394-57302416 ATCAAGGACTTGAGCATCCATGG - Intergenic
1127318848 15:57823023-57823045 ATCAGGGACTTGAGCATCCATGG + Intergenic
1127379294 15:58416341-58416363 ATCAGGGACTTGAGCATCAGTGG + Intronic
1127964723 15:63915006-63915028 ATAAGGGACTTGAGCATCCATGG - Intronic
1128874962 15:71194388-71194410 ACCAAGGACTTGAGTGGGCTGGG - Intronic
1129002333 15:72345103-72345125 ATAAGGGACTTGAGCATCCTTGG - Intronic
1129125846 15:73440744-73440766 AGCAGGGCCCTGGGTGTCCTTGG + Intergenic
1129195439 15:73962312-73962334 ATCAGGGACTTGAGCATGCCCGG - Intergenic
1129267427 15:74401508-74401530 ACCAGGTACTTGGGTTTCCTGGG - Intergenic
1129568017 15:76645199-76645221 ATCAGGGACTTGAACATCCCTGG + Intronic
1129593402 15:76938387-76938409 ATCAGGGAATTGAGTATCCTTGG + Intronic
1129666093 15:77580149-77580171 AGCAGGGACTTGGGGGTGCTAGG - Intergenic
1130117937 15:81021801-81021823 ATCAGGGAGTTGAGCATCCAGGG - Intronic
1130697607 15:86146412-86146434 ATCAGGGACTTGAGCATCTGTGG + Intronic
1131164447 15:90132171-90132193 ATCAGGGACTTGAGCATGCATGG - Intergenic
1131234884 15:90687322-90687344 ATCAGAGACTTGAGCATCCATGG - Intergenic
1131244701 15:90780923-90780945 ATCAGGGACTTGAGCATCCTTGG + Intronic
1131317293 15:91350987-91351009 ATCAGGGACTTGAGCATCCATGG - Intergenic
1131588277 15:93719651-93719673 ATCAGGGACTTGAGCATCTGAGG + Intergenic
1132166723 15:99599982-99600004 ATAAGAGACTTGAGTGTCCTAGG + Intronic
1132257835 15:100392955-100392977 ATCAGGGACTTGAGCATCTGGGG - Intergenic
1132392450 15:101449131-101449153 ATCAGGGACTTGAGCATCTGTGG - Intronic
1132749964 16:1452954-1452976 ATCAGGGACTCGAGTTGCCATGG - Intronic
1134113422 16:11530597-11530619 GTCAGAGACTTGAGTCTCCTGGG - Intergenic
1134198352 16:12176665-12176687 ATAAGGGACTTGAGCACCCTTGG + Intronic
1134543961 16:15093488-15093510 AGCAGGGACATTAGTGTCTTTGG + Intronic
1134746354 16:16591984-16592006 ATCAGGGACTTGAGCTTCTGTGG - Intergenic
1134999126 16:18761716-18761738 ATCAGGGACTTGAGCTTCTATGG + Intergenic
1135352768 16:21743273-21743295 ATAAGGGACTTGAATATCCATGG + Intronic
1135361535 16:21819638-21819660 AGCAGGGACATTAGTGTCTTTGG + Intergenic
1135451255 16:22559395-22559417 ATAAGGGACTTGAATATCCATGG + Intergenic
1136085112 16:27879304-27879326 ATCAGGGACTTGAGCATCCTTGG - Intronic
1136260998 16:29075755-29075777 AGCAGGGACATTAGTGTCTTTGG - Intergenic
1136573890 16:31112066-31112088 TTCAGAGGCTTGAGTCTCCTGGG - Intronic
1137705646 16:50534014-50534036 ATTAGGGTTGTGAGTGTCCTGGG - Intergenic
1138780562 16:59779787-59779809 ATCAGTTACTAGAGTGTTCTGGG - Intergenic
1139093626 16:63678774-63678796 ATAATGGATTTGAGTGGCCTTGG + Intergenic
1139944392 16:70629476-70629498 ATAAGGGACCTGAGCGTCCATGG - Intronic
1140161075 16:72495136-72495158 ATAAGGGACTTGAGCATCCATGG - Intergenic
1140392991 16:74604399-74604421 ATAAGGTACTTGAGCGTCCTTGG + Intronic
1140534272 16:75694889-75694911 ATCAGGAACTTGAGCATCCTTGG + Intronic
1140563107 16:76007595-76007617 ATAAGGGACTTGAGCGTCCATGG + Intergenic
1141207527 16:81944792-81944814 ATCAGGGACTTGAGCCTCCAAGG + Intronic
1141693405 16:85608811-85608833 ATCAGGGACCTGGATGTCCGTGG - Intergenic
1141706308 16:85667043-85667065 ATCAGGGACTTGAACATCCCTGG + Intronic
1142357357 16:89608070-89608092 ATCAGGGACTTGAGCATCCATGG - Intergenic
1142627286 17:1200446-1200468 ATAAGAGACTTGGGCGTCCTGGG + Intronic
1142820935 17:2466614-2466636 AAAAGGGACTTGAGCTTCCTTGG - Intronic
1143693771 17:8594700-8594722 ATAAGGGACTTGAGTATCCATGG - Intronic
1143718235 17:8791273-8791295 AGAAGGGACTTGAGCATCCTTGG + Intergenic
1144148523 17:12421064-12421086 ATAAAGGAATTGAGTCTCCTGGG - Intergenic
1144297824 17:13895856-13895878 ATAAGGGACTTGAGCGTCCCTGG - Intergenic
1145104025 17:20099924-20099946 ATCAGGGACTTGAGCATCCATGG - Intronic
1145213106 17:21030102-21030124 ATCAGGGACTTGAGTATCCATGG - Intronic
1145720808 17:27070815-27070837 ATCAGTAACTTGTGTGACCTTGG - Intergenic
1145759247 17:27416564-27416586 ATCAGAGACTTGAGCATCCATGG - Intergenic
1145799746 17:27675471-27675493 ATCAGAGACTTGAGCATCCATGG + Intergenic
1145823043 17:27855202-27855224 ATAAGGGACTTGAGCATCCTAGG + Intronic
1146845110 17:36177668-36177690 ATCAGAGACTTGAGCATCCATGG + Intronic
1146873331 17:36389517-36389539 ATCAGAGACTTGAGCATCCATGG + Intronic
1146880685 17:36440599-36440621 ATCAGAGACTTGAGCATCCATGG + Intergenic
1147066059 17:37923356-37923378 ATCAGAGACTTGAGCATCCATGG - Intergenic
1147898954 17:43771113-43771135 ATCAGGGACTTGAGCATCTGTGG - Intronic
1149147541 17:53514201-53514223 ATAAGGGACTTGAATATCCATGG - Intergenic
1149487806 17:57057078-57057100 ATCAGGGACTTGAGCATCTGTGG + Intergenic
1149699814 17:58645836-58645858 ATAAGGGACTTGAGCATCTTTGG - Intronic
1149743760 17:59074331-59074353 ATAAGGGACTTGAGTATCTGCGG + Intronic
1149955659 17:61046451-61046473 ATCAGGGACTTGAGCATCTGTGG - Intronic
1150117956 17:62571223-62571245 ATCAGGGACTTGAGCATCCATGG - Intronic
1150258712 17:63771355-63771377 ATAAGGGACTTGAGTATCCATGG + Intronic
1151219053 17:72598375-72598397 GTCAGGAACTTGAGCATCCTTGG + Intergenic
1151781426 17:76248780-76248802 ATCAGGGACTTGAGCATCCAAGG - Intergenic
1153201593 18:2653468-2653490 ATGAGGGACTTGAGCAGCCTTGG + Intergenic
1154081939 18:11265792-11265814 ATCAGGAACTTGAGCATACTAGG - Intergenic
1154115715 18:11611577-11611599 ATCAGGGACTTGAGCATCCATGG + Intergenic
1154120159 18:11645796-11645818 ATCAGGGACTTGAGCATCCATGG + Intergenic
1154200976 18:12300577-12300599 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1154373398 18:13787078-13787100 ATCAGGCACTTGAGCATCCATGG + Intergenic
1155304770 18:24468124-24468146 ATCAGGGACTTCAGCTTTCTTGG - Intronic
1155487588 18:26363051-26363073 ATCAGGGACTTGAGCGTCTTTGG + Intronic
1155628404 18:27862780-27862802 GTCAGGGACTTGAATGTCTGTGG - Intergenic
1155631272 18:27896247-27896269 ATCAAGAACTTGAGTATCCCTGG - Intergenic
1155634872 18:27940595-27940617 ATGAGTGACTTCAGTCTCCTTGG + Intergenic
1155698249 18:28710508-28710530 GTCAGGGACTTGAGCATCCATGG + Intergenic
1156228044 18:35128632-35128654 ATCAGGGACTTCAGCATCCATGG + Intronic
1156235020 18:35194793-35194815 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1156265502 18:35484707-35484729 ATCAGGGACTTGAGGTTCCATGG + Intronic
1156538546 18:37887375-37887397 ATCTGGGAGAAGAGTGTCCTAGG - Intergenic
1158104430 18:53869624-53869646 TTCAGGGACTTGAGAGAGCTGGG + Intergenic
1158383960 18:56967761-56967783 ATCAGGGACTTGAGCATCTATGG - Intronic
1158772410 18:60535420-60535442 ATAAGGGACTTGAGCATCCACGG - Intergenic
1158891801 18:61879396-61879418 ATCAGGGACTTGAGCATGCATGG + Intronic
1158989720 18:62856142-62856164 GTCAGGGACTTGAGCATCCGTGG + Intronic
1159926155 18:74270770-74270792 ATCAGGGACTTGAGCACCTTCGG + Intronic
1160429821 18:78803789-78803811 ATCAGGGACTTGAGCATCCGAGG + Intergenic
1162896394 19:13766945-13766967 ATCAGAGACTTGAGCATCCATGG - Intronic
1163363561 19:16863422-16863444 ATCAGGGACTTGAGTATCTGTGG + Intronic
1163505278 19:17702102-17702124 AACATGGAATTCAGTGTCCTTGG + Intergenic
1163571756 19:18086327-18086349 ATCAGGAACTTGAGCATCTTTGG + Intronic
1164158546 19:22611349-22611371 ACCAGGGACTTGAGTTAGCTGGG - Intergenic
1164267238 19:23631527-23631549 ATCAGAAACTTGAGACTCCTTGG + Intronic
1164544208 19:29145581-29145603 TGCGGGGACTTGTGTGTCCTTGG - Intergenic
1165554853 19:36621757-36621779 ATGAGGGACTTGAGCATCTTTGG + Intronic
1166044830 19:40223690-40223712 AGCACGGGCTTGAGGGTCCTGGG + Intronic
1166255366 19:41600724-41600746 AACAGGGACTTGTGTGATCTTGG - Intronic
1166594068 19:44028883-44028905 AGAAGGGACTTGAGCATCCTTGG - Intronic
1166610422 19:44188581-44188603 GTAAGGGACTTGAGTATCCATGG + Intergenic
1167770148 19:51509761-51509783 ATCAGAGACTTGAGTATCATGGG + Intergenic
1168255679 19:55163607-55163629 ATAAGGGACTTGAGCATCCTTGG + Intronic
925074826 2:1007129-1007151 ATCAGGGACTTGAGTATGTGTGG + Intronic
925561806 2:5204067-5204089 ATCAAGGACTTTAGAGTCTTTGG + Intergenic
926655724 2:15403614-15403636 ATCAGGGACTTGAGCATCCATGG + Intronic
926759689 2:16267208-16267230 ATCTGGGACTTGAGCATCTTTGG + Intergenic
926795220 2:16613372-16613394 AGCAGGGGAATGAGTGTCCTTGG - Intronic
927522824 2:23710846-23710868 ATCAGGGACTTGAGCATCCAGGG + Intergenic
927571631 2:24165464-24165486 ATCTGGGACCTGAGGATCCTTGG - Intronic
927732554 2:25487473-25487495 TTCAGGGACTTGAGCATCCTTGG + Intronic
927871074 2:26624179-26624201 CTCAGGGGCTTGAGTGGTCTGGG - Intronic
928604466 2:32932659-32932681 ATCAGCGACTTGAGCATCCATGG - Intergenic
928646203 2:33355338-33355360 ATCAGGGACTTGAGCATCTGTGG - Intronic
928835801 2:35543209-35543231 ATAAGGGACTTGAGCGTCTATGG + Intergenic
928934580 2:36662050-36662072 ATGAGGGACTTGAGCATCCTCGG - Intergenic
929221998 2:39474333-39474355 ATCAAGGACTTGAGCATCCTTGG - Intergenic
929576839 2:43057371-43057393 CTGAGGGACGTGAGGGTCCTGGG + Intergenic
930004595 2:46886286-46886308 ATCAGGGACTTGAGCATCCATGG + Intergenic
930388897 2:50735555-50735577 ATGAGGGACTGCAGTGTCTTAGG - Intronic
930679129 2:54237154-54237176 GTCAGGGACTTGACTATCCATGG + Intronic
930705905 2:54504660-54504682 ATAAGGGACCTGAGCGTCCATGG + Intronic
931748295 2:65309576-65309598 ATCAGGGACTTGAGCATCTGTGG + Intergenic
932005788 2:67925843-67925865 ATAAGGAACTTGAGCATCCTTGG + Intergenic
932027323 2:68148561-68148583 AGGAGGGACTTCAGTGACCTGGG - Intronic
932035407 2:68241146-68241168 ATCAGGGACTTGAGCATCTGTGG - Intronic
932465399 2:71920372-71920394 ATCAGGGACTTGAGCATCCATGG + Intergenic
933621385 2:84546239-84546261 ATAAGGGACTTGAGCATCCGTGG - Intronic
933697724 2:85232447-85232469 AGCAGTGATATGAGTGTCCTGGG + Intronic
933872811 2:86586018-86586040 ATCAGAGACTTGAGCATCCGTGG - Intronic
933975541 2:87506457-87506479 ATCAGAGACTTGAGCATCCTTGG - Intergenic
934724080 2:96603880-96603902 ATAAGGGACTTGAGCATCCATGG + Intronic
935026494 2:99282085-99282107 ATCAGGGACTTGAGCATCCGTGG - Intronic
935109458 2:100078747-100078769 ATCAGGGAGTTTAGCATCCTAGG - Intronic
935262439 2:101366982-101367004 ATCAGGGACTTGAGCATCCACGG + Intronic
935599735 2:104911029-104911051 ATCAGGGACTTGAGTATTCATGG + Intergenic
935819382 2:106878743-106878765 ATCAGGGACTTGAGCATCCATGG + Intronic
935897778 2:107756248-107756270 ATCAGGCACTTGAGCATCCTTGG + Intergenic
936318284 2:111444356-111444378 ATCAGAGACTTGAGCATCCTTGG + Intergenic
936404770 2:112193121-112193143 ATCAGGGACTTGAGCATCCATGG - Intergenic
936584212 2:113739188-113739210 ATAAGGGACTTGAGCATCTTTGG - Intronic
936953274 2:117999648-117999670 ATCAGGGACTTGAGCATCTGTGG - Intronic
937110274 2:119361629-119361651 ATAAGGGACTTGAGCATCCATGG + Intronic
937172031 2:119882957-119882979 ATAAAGGACTTGATTCTCCTTGG + Intronic
937419528 2:121742179-121742201 GTAAGGGATGTGAGTGTCCTGGG + Intronic
937918026 2:127108557-127108579 ATGAGGGACTTGAGCATCCCTGG - Intergenic
938638164 2:133251247-133251269 ATCGGGGACTTGAGCATCCATGG + Intronic
938752579 2:134347714-134347736 ATAAGGGACTTGAGTATCCTTGG + Intronic
939313509 2:140516436-140516458 ATAAGGGACTTGAGCATCCATGG + Intronic
939808656 2:146805797-146805819 ATCAAGGACTTGAGCATCCTTGG - Intergenic
940782729 2:157950318-157950340 ATCAGGGACTTGAGCTTCCATGG + Intronic
941034393 2:160552226-160552248 ATCATGGACTTAAGTGTCTATGG + Intergenic
941391394 2:164919602-164919624 ATCAGGGACTTGAGCATCCATGG - Intronic
941719461 2:168797963-168797985 ATAAGGGACTTGAATATCTTTGG - Intronic
942383444 2:175417801-175417823 ATCAGGGACTTGAACATCCACGG - Intergenic
942932150 2:181507596-181507618 ATAAGGGACTTGAGGATCCTTGG - Intronic
943360026 2:186907966-186907988 ATCAGGGATTTGAGTGGAGTGGG + Intergenic
943694088 2:190904767-190904789 ATAAGGGACTTGAGTGTCCATGG + Intronic
944171287 2:196781576-196781598 ATAAGGGATTTGAGTATCCAAGG + Intronic
944214922 2:197245410-197245432 GTCAGGGACTTGAGCATCCCTGG + Intronic
944752718 2:202727675-202727697 ATAAGGGACTTGAGTATCTGTGG + Intronic
944942066 2:204639686-204639708 ATCAGGGACTTGAGTATCTGTGG + Intronic
945092918 2:206192842-206192864 ATCAGGGACTTGAGCATCCTTGG - Intronic
945389312 2:209244896-209244918 ATCAGGGATTTGACTTTTCTTGG - Intergenic
945637876 2:212380400-212380422 ACCAGGGACTTGAGTATCCATGG + Intronic
945846403 2:214950226-214950248 ATCAGGGACTTGAGCATCTGTGG + Intronic
946908676 2:224440108-224440130 ATAAGGGACTTGAGTATCCTTGG + Intergenic
947149490 2:227100601-227100623 ATCAGGGACTTGAGCATCTGAGG + Intronic
947152123 2:227126241-227126263 ATCAGGGACGTGAGTATCCATGG + Intronic
947453174 2:230227035-230227057 ATCAGGGACTTGAGCATCCATGG + Intronic
947699696 2:232222319-232222341 ATCAAGTACTTGAGTTGCCTGGG - Intronic
947778378 2:232733680-232733702 ATTAGGGACTTGAGCATCCAAGG - Intronic
947975895 2:234365538-234365560 ATCAGGGACTTGAGTATCTGTGG - Intergenic
948417753 2:237826892-237826914 ATAAGGGACTTGAGCATCCTTGG + Intronic
948667913 2:239547723-239547745 ATCAGGGACTTGAGCATCCCAGG + Intergenic
1169348898 20:4852231-4852253 ATCAGGGACTTGAGTAGTCTCGG + Intergenic
1169937589 20:10901089-10901111 ATAAGGGACTTGAGCATCCATGG - Intergenic
1169982138 20:11396531-11396553 ATCAGGAACTTGAGTGTTCATGG + Intergenic
1170684041 20:18552953-18552975 ATGAGGGACTTGAGTATCTATGG + Intronic
1170875689 20:20247888-20247910 ATGAGGGACTGGAGTGTGTTGGG - Intronic
1171279797 20:23886462-23886484 ATGAGGGACTTCAGTATCCATGG + Intergenic
1171385892 20:24769375-24769397 ATCAGAGGATTGAGTGTCCTGGG - Intergenic
1171478492 20:25433376-25433398 ATAAGGGACTTGAGCATCCATGG - Intronic
1172440529 20:34962484-34962506 ATAAGGGACTTAAGTATCCTTGG - Intergenic
1172497396 20:35397731-35397753 ATCAAGGACTTGAGCATCCACGG + Intronic
1173229518 20:41183361-41183383 AACAGGGACTTGTGAGTACTTGG - Exonic
1174033046 20:47646087-47646109 ATAAGGGACTTGAGCATCCATGG - Intronic
1174442884 20:50569976-50569998 AGCAGGGAACTGGGTGTCCTTGG + Intronic
1174732526 20:52931561-52931583 ATCAGGGACTTGAGTGTTTATGG - Intergenic
1174879640 20:54265000-54265022 ATAAGGGACTTGAGCATCTTGGG + Intergenic
1175249346 20:57599475-57599497 ATCAGGGACTTGAGTATCCATGG - Intergenic
1175738258 20:61402194-61402216 ATCAAGGACTTGAGCATCCTTGG - Intronic
1176176860 20:63731964-63731986 ATAAGGGACTTGAGCATCCTTGG + Intronic
1176665646 21:9685140-9685162 ATCAGGGACTTGAGCGTCTAGGG + Intergenic
1177162602 21:17564178-17564200 ATCAGGGACTTGAGCATCCTTGG - Intronic
1177258985 21:18703882-18703904 ATAAGGGACTTGAGCATCCATGG - Intergenic
1177382594 21:20365017-20365039 ATAATGGACTTGAGTATCCACGG - Intergenic
1177431343 21:20996203-20996225 ATAAGGGACTTGAGCATCCAAGG - Intergenic
1177760432 21:25396615-25396637 AACAGGAACTTGACTGTACTGGG + Intergenic
1177857606 21:26417191-26417213 ACCAGTGACTTCATTGTCCTGGG - Intergenic
1178355946 21:31910785-31910807 ATCAAGAACTTGAGCATCCTTGG - Intronic
1178448397 21:32666933-32666955 GTAAGGGACTTGAGTATCCTTGG - Intronic
1178569150 21:33718549-33718571 ATCAGGGACTTGAGGATCCACGG + Intronic
1178696678 21:34798792-34798814 ATGAGGGACTTGAGCATCCATGG + Intronic
1179096304 21:38318739-38318761 ATAAGGAATTTGAGTATCCTTGG - Intergenic
1179406498 21:41130763-41130785 ATAAGGGATTTGAGCATCCTTGG - Intergenic
1180900361 22:19367294-19367316 ATACGGGACTTGAGCATCCTTGG - Intronic
1181412531 22:22734405-22734427 AACAGGGACTTTAATCTCCTCGG + Intergenic
1181424207 22:22822606-22822628 ATCAGGGACTTTAGTCTCCTTGG + Intronic
1181763871 22:25077334-25077356 ATAAGGGGCATTAGTGTCCTTGG + Intronic
1181835241 22:25600672-25600694 ATAAGGGACTTGAGCATCCTAGG + Intronic
1182862746 22:33574254-33574276 ATCAGAGACTTGAGCATCTTTGG - Intronic
1183135081 22:35879460-35879482 ATCAGGGACTTGAGCATCTGCGG + Intronic
1183142812 22:35959848-35959870 ATCAGGGACTTGAGCATCTGTGG - Intronic
1183305368 22:37080189-37080211 CTCAGGCCCTTGAGTGGCCTGGG - Intronic
1183892625 22:40942546-40942568 CTCAGGGACTTGAAGATCCTGGG - Intergenic
1184292634 22:43506240-43506262 AACAATGACCTGAGTGTCCTAGG + Exonic
1184524732 22:45015127-45015149 ATCAGGGACTTGAGCATCCATGG - Intergenic
1184751692 22:46489940-46489962 ATCTGGGAGTTTATTGTCCTTGG - Intronic
1185194776 22:49462156-49462178 ATCAGGGACTTTAGAGCCCGGGG + Intronic
949126729 3:454072-454094 ATCAGGGACTTGAGCATCTGTGG + Intergenic
949130279 3:491778-491800 ATCAGGGACTTCAGTATCCTTGG - Intergenic
949288523 3:2435269-2435291 ATAAGGGACTTGAGCATCCATGG - Intronic
949654586 3:6202655-6202677 ATCAGGGACTTGAGCATCTGTGG - Intergenic
949698744 3:6730637-6730659 ATCAGGGACTTGAGCATCCTTGG + Intergenic
950883524 3:16343271-16343293 ATCTGGGAGTTGACAGTCCTAGG + Intronic
952134383 3:30400342-30400364 ATCAGAGACTTGAGTATCTGAGG + Intergenic
952386848 3:32848028-32848050 ATAAGGAACTTGAGTATCCTTGG + Intronic
952836072 3:37603429-37603451 ATCAAGGACTTGTGTGTTCTTGG + Intronic
953012196 3:39037701-39037723 ATCAGAGACTAGAGTATACTTGG + Intergenic
953154138 3:40353600-40353622 ATAAGGGACTTGAGCATCCATGG + Intergenic
953340727 3:42132126-42132148 ATCAGGGACTTGAGCATCCATGG - Intronic
953463512 3:43100409-43100431 AACAGGCACTTGAGCATCCTTGG + Intronic
953710794 3:45268664-45268686 AGAAGGGACTTGAGCATCCTCGG - Intergenic
954477719 3:50764484-50764506 ATCAGGGACTTGAGCATCCATGG + Intronic
954573901 3:51664175-51664197 ACCAGGGACTTGAGTTAGCTGGG - Exonic
954704709 3:52473263-52473285 ATCTGGGTCTTGGGTGTGCTTGG + Intronic
955473471 3:59311880-59311902 ATCCGGGACTTGAGTATGCATGG - Intergenic
955676868 3:61457962-61457984 ATAAGGGACTTGAGCATCCATGG - Intergenic
955749473 3:62173057-62173079 ATAAGGGACTTGAGCATCCAAGG - Intronic
955775703 3:62430623-62430645 ATTAGGGAGTTAAGTTTCCTTGG - Intronic
955808643 3:62762728-62762750 ATCAGGGACTTGAGCGTCTGAGG + Intronic
956585477 3:70860077-70860099 ATCATGGACTTGATTATCCATGG + Intergenic
956742743 3:72287904-72287926 ATCAAGGACTTGAGTATCCTTGG + Intergenic
956776034 3:72566356-72566378 ATCAGGAACTTGAGCATCCATGG + Intergenic
956899643 3:73702001-73702023 ATCAGGGACTTGACCATCCATGG - Intergenic
956991630 3:74773031-74773053 ATCAGAGACTTGAGCATCCATGG - Intergenic
957212760 3:77281597-77281619 ATCAGAGACTTGAGCATCCATGG - Intronic
958194375 3:90223965-90223987 ATAAGGGACTTGAGCGTCTGTGG - Intergenic
959152825 3:102628512-102628534 ACCAGGGACTTGAGCATCCTTGG + Intergenic
959172422 3:102859510-102859532 ATAAGGGACTTGAGTTTTCTTGG - Intergenic
959260553 3:104074358-104074380 ATAAGGGACTTCAGCATCCTTGG + Intergenic
959287857 3:104439885-104439907 ATGAGGGACTTGAGCATCCTAGG - Intergenic
960582045 3:119289330-119289352 TTTAGTGACTTGAGTGTTCTGGG + Intergenic
960797547 3:121503671-121503693 ATCAGAGACTTGAGCATCCATGG - Intronic
960883851 3:122374391-122374413 ATCAGGGACTTGAGCATCCTTGG - Intronic
960905582 3:122597822-122597844 ATAAGGGACTTGAGGATCCATGG - Intronic
961409586 3:126708973-126708995 ATTAGGGACTTGAGCATCCAAGG - Intronic
961501813 3:127341526-127341548 ATCAGGGACTTGAGCATCCACGG - Intergenic
962917877 3:139922969-139922991 ATAAGGGACTTGAGCATCCATGG - Intergenic
963529609 3:146457940-146457962 ATCAGGGACTTGAGTAGCCTAGG - Intronic
963750790 3:149177466-149177488 ATAAGGGACTTGAGCATCCATGG - Intronic
963775938 3:149440210-149440232 ATCAGGGACTTGAGCATCTGTGG + Intergenic
964504930 3:157388868-157388890 ATAAGTGATTTGAGTATCCTTGG + Intronic
964579321 3:158214162-158214184 GTAAGGGACTTGAGCATCCTTGG + Intronic
965062263 3:163799510-163799532 ATCAGAGAATTGAGTGTACAGGG - Intergenic
966890290 3:184402468-184402490 ATCAGAGACTTGAACATCCTTGG - Intronic
966898406 3:184462958-184462980 ATCAGGGACTTGAGCATCCATGG + Intronic
967074332 3:185988667-185988689 ATCAGGGACCTGAAAATCCTAGG + Intergenic
967471789 3:189870489-189870511 ATAAGGGACTTGAGCAACCTAGG + Intronic
967474818 3:189904304-189904326 ATAAGGGGCTTGAGGGGCCTAGG - Intergenic
968033564 3:195525376-195525398 ATCAGAGACTTGAGTGTCTGAGG + Intronic
968053359 3:195672098-195672120 ATTAGGGACTTGAGCATCCACGG + Intergenic
968102453 3:195976264-195976286 ATTAGGGACTTGAGCATCCACGG - Intergenic
968446056 4:652750-652772 ATCCGGGACTTGAACATCCTCGG + Intronic
968558451 4:1262504-1262526 ATCACGGACTTGAGCATCCGGGG - Intergenic
968842863 4:3021010-3021032 ATCAGGGACTTGAGGACCCTTGG + Intronic
969625517 4:8303170-8303192 TTCTGCCACTTGAGTGTCCTGGG - Intronic
969685891 4:8674035-8674057 GTCAGGGATTTGAGCATCCTTGG + Intergenic
970004484 4:11397363-11397385 ATCAGGGAAGTGAGTCACCTTGG - Exonic
970211986 4:13719517-13719539 ATCAGACACTTGAGTGTCATGGG + Intergenic
970652040 4:18189515-18189537 ATAAGGCACTTGAGTATCCATGG - Intergenic
970965238 4:21920696-21920718 ATCAGGGACTTGAGCATCCATGG + Intronic
971622598 4:28874933-28874955 ATAAGGGACTTGAGTATCTGTGG + Intergenic
972603861 4:40596126-40596148 AGCAGGGACGTGACTATCCTTGG + Intronic
972706159 4:41545025-41545047 TACAGGGACTTCAGTGTCATAGG + Intronic
973998603 4:56486007-56486029 ATAAGGGACTTGAGCATCCTTGG + Intronic
974257080 4:59471675-59471697 ATAAGGGACTTGAGCATCCATGG + Intergenic
974771478 4:66420152-66420174 ATCAGGGACATTAGACTCCTGGG + Intergenic
974859753 4:67505489-67505511 ATAAGGGACTTGAGCATCCTTGG - Intronic
975383168 4:73726248-73726270 AGAAGGAAGTTGAGTGTCCTTGG + Intergenic
975641654 4:76506453-76506475 ATAAGGGACTTGAGCATCCATGG + Intronic
976403051 4:84629563-84629585 ATAAGGGACTTGAGCATCCATGG + Intronic
976419641 4:84826365-84826387 ATCAGGGACTTGAGTATCTGTGG + Intronic
976622939 4:87147514-87147536 ATCAGGGACTTCAGCATCCTTGG - Intergenic
976735365 4:88303552-88303574 CTAAGGCACTTGAGTATCCTTGG + Intergenic
977248983 4:94667569-94667591 ATCATGGACTTTAGTATCCTAGG + Exonic
977324855 4:95562374-95562396 ATCAGGGACTTGAGCATCTGTGG - Intergenic
977663527 4:99618220-99618242 ATAAGGGACTTGAGCACCCTTGG + Intronic
977676245 4:99751022-99751044 ATCAGGGATTTGGGCATCCTTGG + Intergenic
978361368 4:107933672-107933694 ATCAGGGACTTGAGCATCCTAGG - Intronic
978555408 4:109974162-109974184 ATCAGGGAATTGAGCATCCTTGG + Intronic
979661555 4:123261559-123261581 ATAAGGGACTTCAGCATCCTTGG + Intronic
979871324 4:125826119-125826141 ATAAGGGACTTGAGTATCTATGG + Intergenic
979915236 4:126423602-126423624 ATCAGGGACTTGAGCATTCATGG - Intergenic
980947183 4:139332960-139332982 ATCAAGGACTTGAGCATCCCTGG - Intronic
981025414 4:140072738-140072760 ATCAGGGACTTTAGCATCCCTGG + Intronic
981303719 4:143222349-143222371 ATAAGGGACTTGAGTATCTGTGG - Exonic
982024241 4:151235883-151235905 ATAAGGGACTTTGGTTTCCTGGG - Intronic
982558457 4:156899326-156899348 AGCAGGGACTTGAGCAACCTTGG + Intronic
983397401 4:167217516-167217538 ATAAGGGACTTGAGGATCCATGG + Intronic
983445233 4:167842157-167842179 GTCAGTGACTTAGGTGTCCTGGG - Intergenic
983499818 4:168486244-168486266 ATAAGGGACTTGAGTATCCATGG - Intronic
984074164 4:175154029-175154051 CTTTGGGACTTGAGTATCCTAGG - Intergenic
984609457 4:181821103-181821125 ATCAGGGACTTTGGTGCACTGGG - Intergenic
984792180 4:183625038-183625060 ATCAGGGACTTGAGCATCCTTGG - Intergenic
984813205 4:183813520-183813542 GTCAGGGACTTGAGCATCCGTGG + Intergenic
984985186 4:185321963-185321985 ATCAGGGACTTGAATGTCCTCGG + Intronic
985081384 4:186268326-186268348 ATCAGGGACTTGAGCGTTCATGG + Intronic
985205623 4:187532423-187532445 ATCAGGGACTTGAGCATCCCAGG + Intergenic
985296402 4:188441847-188441869 ATCAGGGTCTTGAGCATCCACGG + Intergenic
985411368 4:189689404-189689426 ATCAGGGACTTGAGCGTCTAGGG + Intergenic
985499651 5:234752-234774 ATTAGGGACTTGAGCATCCACGG + Intronic
986257934 5:6116567-6116589 ATCAGGGACTTGAGCATTCCTGG + Intergenic
986587102 5:9329813-9329835 ATCAGGGACTGGAGCATCCATGG - Intronic
987248299 5:16072741-16072763 ATCAGGGGCTTGCATTTCCTGGG + Intronic
987306686 5:16644098-16644120 ATCAGGGACTTGAGCATCCTTGG + Intergenic
987788725 5:22536071-22536093 ATAAGGGACTTGAGTATCTTTGG + Intronic
987953889 5:24712397-24712419 ATAAAGGACTTGAGCATCCTTGG + Intergenic
987985342 5:25139059-25139081 ATCAGGAACTTGAGTTTCCATGG - Intergenic
988439008 5:31210634-31210656 ATAAGGGACTTGAGCATCCTTGG - Intronic
988789636 5:34595433-34595455 ATAAGGGACTTAAGTTCCCTGGG + Intergenic
988791000 5:34607531-34607553 ATCAGGGACTTGAGCATCCATGG + Intergenic
988963815 5:36395128-36395150 ATCAGAGACTTGAGCATCCTTGG - Intergenic
989024199 5:37047155-37047177 ATCAGGGACTTGAGAATCCACGG + Intronic
989126100 5:38053638-38053660 ATAAGGGAGTTGAGCGTCCTCGG - Intergenic
989280578 5:39638151-39638173 ATAAGGGATTTGAGCATCCTTGG - Intergenic
989283027 5:39666517-39666539 ATCAGGGACTTGAGCATCTTTGG - Intergenic
989509129 5:42263444-42263466 ATCAGGTACTTGAGCATCCATGG - Intergenic
989514471 5:42326043-42326065 ATAAGGGACTTGAGCATCCATGG + Intergenic
990219062 5:53566626-53566648 ATCAAGGACTTGAGCATCCGTGG - Intronic
990402107 5:55448832-55448854 ATCAGGGACTTGAGCATCCATGG - Intronic
990845562 5:60134598-60134620 ATCAGGGGCTTGAGCATCCATGG - Intronic
990848193 5:60168590-60168612 ATCAGGGACATGAGCATCCGTGG - Intronic
990964179 5:61427253-61427275 ATAAGGGACTTAAGCATCCTAGG - Intronic
991580845 5:68153507-68153529 ATCACAGACTTGAGCGTCCCAGG - Intergenic
991603879 5:68380809-68380831 ATCAGGGACTTGAGCATCACTGG - Intergenic
991913099 5:71581013-71581035 ATAAAGGACTTGAGCATCCTGGG - Intergenic
992593249 5:78317853-78317875 ATCAGGGGCTGGAGTCTGCTAGG - Intergenic
992732499 5:79687432-79687454 ATAAGGGACTTGAGTATCTGTGG - Intergenic
992881211 5:81112393-81112415 ATCAGGGACTTGAGCATCTGTGG + Intronic
994236171 5:97365630-97365652 AGCAGGGTTTTGAGTGTCCCTGG + Intergenic
994458223 5:100041777-100041799 AGCAGGGAGTTGAGGGTCTTAGG + Intergenic
995176128 5:109179793-109179815 ATCAGGGATTTGAGCATCTTTGG + Intronic
995363786 5:111330670-111330692 ATAAGGGACTTGAGCATCCATGG + Intronic
995708374 5:115009342-115009364 ATCAGGGACTTGAGCATCCATGG - Intergenic
996897929 5:128507336-128507358 ATCAGGGACTTGAGCCTCTATGG - Intronic
996949359 5:129107677-129107699 ATCAGGGACTTGAGCATCCATGG + Intronic
997555974 5:134799083-134799105 ATAAGGGACTTGAGCATCCTAGG + Intronic
998579299 5:143354502-143354524 CTCAGGGATTTGAGAGTCCCAGG + Intronic
999109422 5:149105343-149105365 ATCAGGGACTTGAGCATCTGTGG - Intergenic
999371470 5:151057903-151057925 ATCAGGGACTTGAGCATCCATGG + Intronic
1000287833 5:159843021-159843043 ATCAGGAATTTGAGCATCCTTGG + Intergenic
1002173811 5:177390267-177390289 ATCAGACACTTGAGTCTCCCGGG + Intronic
1002425412 5:179171902-179171924 AACAGGCACTGGGGTGTCCTGGG + Intronic
1002496095 5:179612594-179612616 ATCAGGGACTTGAATCTAATGGG + Intergenic
1002513532 5:179739821-179739843 GTAAGGGACTTGAGCATCCTTGG + Intronic
1002658092 5:180769565-180769587 ATCAGGAATTTGACTGTCCTGGG + Intergenic
1002883340 6:1272281-1272303 ATCAGGGACTTGAGCATCCATGG + Intergenic
1002958014 6:1887787-1887809 ATAAGGGAGTTGAGCATCCTTGG - Intronic
1003284521 6:4723283-4723305 ATCAGGGACTTGAGCATCTGTGG + Intronic
1003383511 6:5646634-5646656 ATCAGGGACTTGAGCATCCCTGG - Intronic
1003609870 6:7602241-7602263 ATCAGAGACTTGAGCATCCATGG + Intronic
1003678259 6:8227093-8227115 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1004167719 6:13271547-13271569 ACAAGGGACTTGAGCTTCCTTGG - Intronic
1004595210 6:17093181-17093203 ATAAGGGACTTGAGCATCCATGG - Intergenic
1004719924 6:18260108-18260130 ATAAGGGACTTGAGCATCCATGG - Intronic
1005038087 6:21575712-21575734 ATCTGAGACTTGTGTTTCCTTGG + Intergenic
1005202838 6:23366292-23366314 ATAAGGGACTTGAGCATCCCTGG - Intergenic
1005407670 6:25507271-25507293 ATCTGTGACTTGAATGTTCTTGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006422774 6:33945578-33945600 ATCAGAGACTTGGGTATCCTTGG - Intergenic
1006567249 6:34970494-34970516 ATAAGGGACTTGAGCATCCTTGG - Intronic
1006775551 6:36589726-36589748 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1006888374 6:37401041-37401063 ATCAGGGACTTGAGCATCTGTGG - Intergenic
1006955306 6:37864859-37864881 ATCAGGGACTTGAGCATCCTCGG - Intronic
1008417641 6:51261550-51261572 TGATGGGACTTGAGTGTCCTTGG - Intergenic
1008890071 6:56477752-56477774 ATCAGGGACTTGAGCATCATTGG - Intronic
1009481125 6:64159101-64159123 ATCAGGGACTTGAACATCCAGGG - Intronic
1009913969 6:69969705-69969727 ATAAGGGACTTGAGCATCCATGG + Intronic
1009992908 6:70865549-70865571 ATCAGGGACTTGAGCGTCCATGG + Intronic
1010720548 6:79278488-79278510 ATAAGGGACTTGAGCATCCAAGG - Intergenic
1010748289 6:79589000-79589022 ATAAGGAACTTGAATATCCTTGG - Intergenic
1010753622 6:79642355-79642377 ATAAGGGACTTGAGCATCCAAGG + Intronic
1010754991 6:79656771-79656793 ATCAAGGATTTGAGCATCCTTGG + Intronic
1011097170 6:83679214-83679236 ATCAGGGACTTGAGCTTCCACGG + Intronic
1011261439 6:85474113-85474135 ATAAGGGACTTGAGCATCCATGG - Intronic
1011989269 6:93492264-93492286 ATAAGGGCCTTGAGTGTCCATGG - Intergenic
1012329780 6:97970366-97970388 ATAAAGGACTTGAGTATCCGAGG + Intergenic
1012929280 6:105299649-105299671 AACAGGGACTTGGGAGACCTTGG - Intronic
1013137710 6:107298493-107298515 ATCAGGGACTTGAGCATCCAAGG + Intronic
1013505863 6:110799422-110799444 ATCAGGGACTTGAGCATTCTTGG - Intronic
1014010547 6:116470390-116470412 AGAAGGGACTTGAGTATCCATGG - Intergenic
1014459529 6:121679526-121679548 ATCAGGGACTTGAGCATCCATGG + Intergenic
1014487979 6:122024090-122024112 ATTAGGGACTTGAGCATCCACGG - Intergenic
1014594752 6:123321156-123321178 ATCAGGCAATTGTGTGACCTGGG + Intronic
1014768213 6:125431739-125431761 ATCAGGGACTTGAGTATCCATGG - Intergenic
1015372735 6:132473343-132473365 ATCAGGGACTTGAGCATCAGCGG - Intronic
1015629408 6:135216248-135216270 ATCAGGGACTTGAGCATCCCTGG - Intronic
1015894471 6:138003383-138003405 ATCAGGGACTTGAGCATCTGAGG + Intergenic
1015945998 6:138501774-138501796 ATCAGGGACTGGAGCATCCAAGG - Intronic
1016604572 6:145905501-145905523 ATAAGGGCCTTGAGCATCCTGGG - Intronic
1016717403 6:147250533-147250555 ATGAGGGACTTGAATATCTTTGG + Intronic
1016848356 6:148591636-148591658 ATCAGGGACTTGAGCATCCAGGG + Intergenic
1016932134 6:149421949-149421971 ATCAGGAACTTGAGCATCCGAGG - Intergenic
1017475281 6:154784726-154784748 ATAAGGGACGTGAGCATCCTCGG + Intronic
1017782274 6:157724894-157724916 ATCAGGGACGTGAGTATCCAAGG + Intronic
1017803179 6:157917620-157917642 ATCAGGGACTTGAGCATCAATGG - Intronic
1018381497 6:163261876-163261898 ATCAGGGACTTGAGCATCTGTGG + Intronic
1018614921 6:165677658-165677680 ATCAGGGACTTGAACGTCGGTGG + Intronic
1018637794 6:165879610-165879632 ATCAGCGACTTGAGCATCCGAGG - Intronic
1018775020 6:167006661-167006683 ATAAGAGACTTGAGCATCCTTGG + Intronic
1018776101 6:167017437-167017459 ACGAGGGACTTGAGCATCCTCGG + Intronic
1019000529 6:168746073-168746095 ACCAGGGACTTTAGTTTCCCAGG + Intergenic
1019378392 7:708409-708431 ATCAGGGACTTCAGCATCCATGG - Intronic
1019648476 7:2143568-2143590 ATAAGGGACTCGAGAGTCATTGG - Intronic
1019767370 7:2861585-2861607 ATTAGGGACTTGAGCATCCAGGG - Intergenic
1019919878 7:4156784-4156806 TTCAGAGACTTCAGAGTCCTGGG + Intronic
1021188421 7:17592404-17592426 ATCAGATACTTCAGTGTCCTTGG - Intergenic
1021645717 7:22787520-22787542 ATAAGGGACTTGAGTGTCCATGG - Intergenic
1022122473 7:27322953-27322975 ATCAGGGACTTGAGCATCCATGG + Intergenic
1022246059 7:28560489-28560511 AACAGGGTCTGGAGTGTTCTGGG + Intronic
1022598608 7:31735878-31735900 ATAAGAGACTTGAGCATCCTTGG - Intergenic
1022714481 7:32886558-32886580 ATCAGAGACCTGAGTGTCCTTGG + Intronic
1023052000 7:36261009-36261031 ATCAGGGACTTGAGCATCTGTGG + Intronic
1023114707 7:36851349-36851371 ATAAGGGACTTGAGCATCCTGGG + Intergenic
1023253271 7:38287863-38287885 ATCAGGGACTTGAGCATACATGG - Intergenic
1023900241 7:44471178-44471200 ATCAGGGACTTGAGCATCGTTGG - Intronic
1024567303 7:50692218-50692240 ATCAGGGCCTTGAGCATCCTTGG + Intronic
1024672627 7:51609856-51609878 ATCAAGGACTTGAGCATCCTTGG - Intergenic
1026548946 7:71350681-71350703 ACAAGGGACTTGAGCATCCTTGG + Intronic
1027186976 7:75978495-75978517 AGCAGGGACTTGAGCATCCTTGG + Intronic
1027344210 7:77240446-77240468 ATCAGGGACTGGAGTATCCATGG - Intronic
1028288978 7:89041492-89041514 ACCTGGCACTGGAGTGTCCTTGG + Intronic
1028520026 7:91719869-91719891 ATAAGGGACTTGAGCATCCATGG + Intronic
1028556547 7:92132289-92132311 ATAAGGGACTTGAGGATCCCTGG - Intronic
1028574125 7:92327423-92327445 ATAAGGGACTTGAGTATCTGTGG - Intronic
1028707012 7:93861204-93861226 ATAAGGGATTTGAGTGTCCATGG + Intronic
1028834476 7:95359057-95359079 ATCAGGGACTTGAGCATCCGTGG - Intergenic
1029219817 7:98979291-98979313 ATCAGGGACTTGAGTGTCCGTGG - Intronic
1030015264 7:105213046-105213068 ATCAAGGACTTGAGCATCCATGG + Intronic
1030316073 7:108115792-108115814 ATCAGGGACTTGAGCATCCATGG + Intronic
1030581052 7:111356470-111356492 ATCAGGGATTTGAGCATCCTCGG + Intronic
1030589825 7:111466935-111466957 ATCAGGGACTTGAGCATCTTTGG + Intronic
1030821664 7:114099718-114099740 ATCAGAGACTTGAGCATCCTTGG - Intronic
1030933242 7:115551765-115551787 ATCAAGGACTTGAGCATCCATGG - Intergenic
1031741926 7:125443404-125443426 ATCAGGGACTTGAGCATCCATGG - Intergenic
1031831787 7:126636343-126636365 ATCGGGAACTTGAGTGTCCTTGG - Intronic
1032158471 7:129490773-129490795 ATCAAGGACTTGAGCATCCAAGG + Intergenic
1032309942 7:130775891-130775913 ATAAGGGACTTGAGCATCCATGG + Intergenic
1032562126 7:132903151-132903173 ATCAGGGACTTGAGCGTTTGTGG - Intronic
1032636495 7:133714754-133714776 ATCAGGTACTTGAGCATCCATGG + Intronic
1032885719 7:136136118-136136140 TTGTGGGACTTGAGTGTACTTGG + Intergenic
1032900329 7:136300139-136300161 ATCAGGGACTTGAGCATCTATGG + Intergenic
1033198103 7:139344316-139344338 GTCAGGGACTTGAGCATCCATGG - Intronic
1034144073 7:148852920-148852942 ATCAGGGACTTGAGTCTTCGTGG - Intronic
1034178543 7:149119938-149119960 ATAAGGGACTTGAGCATCCATGG + Intronic
1034498297 7:151434624-151434646 ATCAGGAACTTGAGCATCCTCGG - Intronic
1034953491 7:155317230-155317252 ATCAGAGACCAGAGTGTCTTCGG + Intergenic
1035131095 7:156654377-156654399 ATCAGGGACTTGAGCATCCTTGG + Intronic
1035597807 8:872907-872929 ATCAGGGACTTGAGCATCCGTGG - Intergenic
1035718826 8:1775292-1775314 ATAAGGGACTTGAGCATCCGTGG + Intronic
1035965427 8:4186391-4186413 GTCAGGGACTGGACTGTCTTGGG - Intronic
1036282242 8:7410438-7410460 ATCAGGGACTTGAGCATCTGAGG + Intergenic
1036339226 8:7901133-7901155 ATCAGGGACTTGAGCATCTGAGG - Intergenic
1036424341 8:8629781-8629803 ATCAGAGATTTGACTTTCCTGGG - Intergenic
1036507859 8:9372027-9372049 AGCAGGGACATCAGTCTCCTTGG + Intergenic
1036909062 8:12737562-12737584 ATCAGGGACTTGAGCATCCTTGG + Intronic
1036938714 8:13031109-13031131 TTCAGGGACTTGAGCATCCATGG + Intronic
1037331176 8:17745264-17745286 ATAAGAGATTTGAGTGTCCATGG - Intronic
1037414165 8:18630946-18630968 ATCAGGGACTTGAGTGTCCTTGG + Intronic
1037431747 8:18820442-18820464 ATCAGGGACTTGAACATCCATGG - Intronic
1038185532 8:25270824-25270846 ATCAGAGACTTGAGCATCCATGG - Intronic
1038217209 8:25573324-25573346 ATCCCGGCCTTAAGTGTCCTGGG + Intergenic
1038392118 8:27211662-27211684 ACCAGGGACTTGAGCATCCTTGG + Intergenic
1038511479 8:28140025-28140047 ATGAGGGACTTGAGCATCCATGG + Intronic
1038774242 8:30513615-30513637 ATCAGGGACTCGAATCTCCTTGG + Intronic
1038801257 8:30751041-30751063 ATCAGGGACTTGAGCATCCGTGG + Intronic
1039014525 8:33131030-33131052 ATCAGAGACTTGAGCATCCATGG - Intergenic
1039022684 8:33224940-33224962 ATCAGGGACTTGGGCATCCTTGG - Intergenic
1039393414 8:37201736-37201758 ATCAGGGACTTGAGCTTCCATGG + Intergenic
1039953877 8:42192708-42192730 ATGAGGAACTTGAGTATCCCTGG + Intronic
1040431967 8:47351839-47351861 ATCAGGAACTTGAGCATCCTTGG + Intronic
1040731349 8:50451330-50451352 ATAAGGGACTTGAGCATCCACGG + Intronic
1040869174 8:52082522-52082544 ATCAGGGACTTGAGTTTTGTTGG + Intergenic
1040980851 8:53244925-53244947 ATCAGGGACTGGAGCATCCATGG - Intronic
1041103560 8:54420050-54420072 ATCAGGGACTTGAGCATCCATGG + Intergenic
1041137557 8:54776499-54776521 ATAAGGGACTTGAGCATCTTTGG + Intergenic
1042288233 8:67138267-67138289 ATCAGGAACTTGAGCATCCATGG - Intronic
1042445504 8:68880522-68880544 ATCAGGAACTTGAGCATCCATGG - Intergenic
1042570543 8:70159071-70159093 TTCAGGGACTTGAGCATCCATGG - Intronic
1043540551 8:81257611-81257633 ATCAAAGACTTGAGGGTTCTAGG + Intergenic
1044246253 8:89950257-89950279 ATCAGGGACTTGAGCATCCATGG - Intronic
1044644804 8:94428415-94428437 ATAAGGGACTTGAGTATCTGTGG - Intronic
1044653214 8:94520705-94520727 ATCAGAGACTGGAGCATCCTTGG + Intronic
1045185366 8:99831821-99831843 ATAAGGGACTTGAGCATCCGTGG + Intronic
1045577675 8:103443702-103443724 ATCAAGGACTTGGGCATCCTTGG - Intergenic
1045823832 8:106373176-106373198 ACCTGGAACTTGAGTATCCTTGG + Intronic
1046837788 8:118822082-118822104 ATTAGGGACTTGAGCATCCTTGG - Intergenic
1047867547 8:129043489-129043511 ATCAGGAACTTGAGCATCCTTGG - Intergenic
1048023768 8:130565275-130565297 ATCAGGGGCTTAATTGTACTTGG + Intergenic
1048595001 8:135857378-135857400 ATAAGAGACTTGAGCATCCTTGG + Intergenic
1049692409 8:143967601-143967623 ATCAGGGACTTGAGCATCTGTGG - Intronic
1049756443 8:144313197-144313219 ATCAGGGATTTCAGTGTTCAGGG - Intronic
1050188421 9:2999249-2999271 ATAAGGGACTTGAGCATCCAAGG - Intergenic
1050254113 9:3776369-3776391 AACAGGGAGGTGAGTGTCCCAGG - Intergenic
1050341238 9:4641322-4641344 ATCAGGGACTTGAGCATTCATGG - Intronic
1050649445 9:7759454-7759476 ATCAGAGACTTGAGCATCCATGG - Intergenic
1051466689 9:17385837-17385859 ATCAGGGACTTGAGCATGGTTGG + Intronic
1051675503 9:19554443-19554465 ATCAGGGACTTGAGCATCCATGG + Intronic
1052662610 9:31454812-31454834 ATCAGGGACTTGAGCATCAGTGG - Intergenic
1052809092 9:33041197-33041219 ATCAGGGACTTGAGTACCCTCGG + Intergenic
1052810419 9:33053516-33053538 GTGTGGGACTTGAGTATCCTTGG - Intronic
1053151026 9:35743099-35743121 ATCAAAGACTTGAGCATCCTCGG + Intronic
1054727478 9:68666814-68666836 ATAAGGGACTTGAGCATCCATGG + Intergenic
1054743074 9:68828104-68828126 ACCAGGGCCTTGACTGTCATGGG + Intronic
1054769706 9:69072014-69072036 ATCAGGGACTTGAGTACCCACGG + Intronic
1054835304 9:69670796-69670818 AGCAGGGACTTTACTGACCTGGG + Intronic
1054968389 9:71056088-71056110 GTCAGATACTTGAATGTCCTTGG - Intronic
1055169292 9:73235627-73235649 ATCAGGGACTTGAGCATCCATGG + Intergenic
1055601709 9:77925843-77925865 ATCAGGTACTTGAGCATCCTTGG - Intronic
1056120292 9:83480846-83480868 ATAAGGGACTTGAGCATCCTCGG + Intronic
1056466689 9:86863096-86863118 ATCAGAGACTTGAGCATCCTCGG + Intergenic
1056789355 9:89615736-89615758 TTTAGGGGCTTGAGTGTCCTGGG + Intergenic
1059071260 9:111138960-111138982 ATCAGGTACTTGAGTATCCATGG + Intergenic
1059298656 9:113295494-113295516 ATCAGGGGCTTGAGCATCCTCGG + Intergenic
1060159886 9:121352133-121352155 ATAAGAGACTTGAGCATCCTTGG - Intronic
1060198479 9:121638343-121638365 GTCAGGGACTTGAGCGTGCTTGG + Intronic
1060927483 9:127465148-127465170 ATCAGGCCCCTTAGTGTCCTGGG - Intronic
1061098667 9:128475252-128475274 ATCAGGGACTTGAGCATCTTTGG + Intronic
1061607448 9:131721901-131721923 ATCAGGGACTTGAGCATCTGTGG + Intronic
1062270182 9:135704695-135704717 ATCAGGGCCTAGAGGGTCCCAGG - Intronic
1062512623 9:136915615-136915637 ATCAGGGACTCGAGCATCCTTGG + Intronic
1203660457 Un_KI270753v1:36621-36643 ATCAGGGACTTGAGCGTCTAGGG - Intergenic
1203671228 Un_KI270755v1:13578-13600 ATCAGGGACTTGAGCGTCTAGGG - Intergenic
1185783505 X:2869319-2869341 ATCAGAGACTTGAGCATCCGTGG + Intronic
1186424446 X:9452865-9452887 ATCAGGGACATGAGCATCCGTGG + Intergenic
1186493895 X:9996808-9996830 ATCATGGACTTGAGCATCCTTGG + Intergenic
1186662391 X:11682056-11682078 ATAAGGGACTTGAGCATCCATGG - Intergenic
1186676278 X:11821001-11821023 ATTAGGGACTTGAGCATCCATGG + Intergenic
1186925782 X:14331904-14331926 ATAAGGAACTTGAGCTTCCTTGG + Intergenic
1186930108 X:14379940-14379962 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1186975996 X:14905419-14905441 ATGAGGGACTTGAGCATCCAAGG - Intronic
1187084549 X:16028525-16028547 ATAAGGGACTTGAGTGTCCTTGG + Intergenic
1187328291 X:18312326-18312348 ATCAGGGACTTGAGTGTCCTTGG - Intronic
1188032599 X:25281513-25281535 ATAAGGGACTTGAGAATCCTTGG + Intergenic
1188302327 X:28520087-28520109 ATCAGGGACTTAAGCGTCTGAGG - Intergenic
1188408708 X:29844729-29844751 ATCGGGGACTTGAGCATCCTTGG + Intronic
1189149059 X:38685827-38685849 ATCAAGGACTTGAGCATCCTAGG + Intronic
1189262856 X:39690072-39690094 CTCAGGGACTTGGGGGTCCATGG + Intergenic
1189269233 X:39739201-39739223 ATCAGGTATTTGAGGCTCCTGGG - Intergenic
1189398475 X:40644672-40644694 ATCAGGGACTTGAGCATCTGTGG + Intronic
1189577145 X:42366110-42366132 ATAAGGGACTTGAGCATCCATGG + Intergenic
1189980723 X:46507559-46507581 ATCAGGGATTTGAGTATCAATGG + Intronic
1190250415 X:48719758-48719780 ATAAGGGACTTGAGTGTTCACGG + Intergenic
1192242318 X:69342454-69342476 ATAAGGGACTTGAGCATCCATGG - Intergenic
1192399641 X:70821975-70821997 ATAAGGGACTTGAGTATCTGTGG - Intronic
1193325663 X:80176559-80176581 AGTAGGGGCATGAGTGTCCTAGG - Intergenic
1193697171 X:84723585-84723607 ATCAGGGCCTTGAGTGACATAGG - Intergenic
1194134131 X:90117939-90117961 AGCAGGGACTTAAGAGTTCTAGG - Intergenic
1194292954 X:92097789-92097811 ATAAGGGACTTGAGCGTCTAAGG - Intronic
1194997296 X:100604787-100604809 ATCAGGGACTTGAGCATTCGAGG - Intergenic
1195255959 X:103091527-103091549 GTAAGGGACTTGAGTATACTTGG + Intronic
1195600130 X:106737393-106737415 ATCAGGGACTTGAGCATCTGTGG - Intronic
1195939218 X:110153613-110153635 ATTAGGGACTTGAGCATCCTTGG - Intronic
1195993813 X:110710964-110710986 ATCAGGGACTTGAGCATCTGTGG - Intronic
1196237160 X:113296046-113296068 AGCAGTGTCTTGACTGTCCTTGG - Intergenic
1196710864 X:118760806-118760828 ATCAGGGACTTGAGCATCCATGG - Intronic
1197657691 X:129135225-129135247 ATCAGGAGCTTGAGCATCCTTGG + Intergenic
1197669584 X:129261436-129261458 ATCAGGGACTTGAGCATCCTTGG - Intergenic
1198411274 X:136371845-136371867 ATCAGGAACTTGAGCATCCGTGG + Intronic
1199286201 X:146057315-146057337 ATCAGGGACTTGAGCATTCTTGG - Intergenic
1199435395 X:147806635-147806657 ATCAGGGATTTGAGCATCCACGG + Intergenic
1199610301 X:149606936-149606958 ATCAGGGACTTGAGCATCCATGG - Intronic
1200129610 X:153833843-153833865 ATCAGGGATTTGGGTGTCCATGG - Intergenic
1200242264 X:154503272-154503294 ATCAGGGACTTGAGCATCCCTGG - Intergenic
1200245861 X:154524950-154524972 ATCAGGGACTTGAGCATCTGTGG + Intergenic
1200760830 Y:7037263-7037285 ATCAGGGACTTGAGTATCTATGG - Intronic