ID: 1187330904

View in Genome Browser
Species Human (GRCh38)
Location X:18338615-18338637
Sequence TAGGTTAGACAGGAGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187330904 Original CRISPR TAGGTTAGACAGGAGGGGCT GGG Intronic
903263142 1:22142175-22142197 TAGGCTAGACACGGGGAGCTGGG + Intronic
903806612 1:26010228-26010250 TAGGTTATGCAGGCTGGGCTGGG + Intergenic
904696861 1:32335900-32335922 GAGGTGCGAGAGGAGGGGCTGGG + Intronic
905084597 1:35360863-35360885 TAGGATAGACAGAGGGGACTTGG + Intronic
906511761 1:46414027-46414049 TAGGTGAGAGAGGAGGGGCACGG - Intergenic
907359343 1:53902243-53902265 TATTTTAGACAGGCGGGGCAGGG - Intronic
911563420 1:99434128-99434150 TAGGTGGGACAGGAAGGGCTGGG - Intergenic
915581422 1:156815314-156815336 TAAAATAGACAGGAGAGGCTGGG - Intronic
915820617 1:159019660-159019682 TATGTTAGCCAGGATGGTCTTGG + Intronic
918091232 1:181296979-181297001 GAGGTTAGACAGGAGTAGCAGGG + Intergenic
918109704 1:181444669-181444691 GGGGTCAGACAGGAGGGGCAGGG - Intronic
920666459 1:207966107-207966129 GAGGTGAGACAGGAGGGGATGGG + Intergenic
921153932 1:212423644-212423666 TGGGTAATACAGGTGGGGCTGGG - Intergenic
1064250858 10:13705480-13705502 TAGGATAAAAATGAGGGGCTGGG - Intronic
1065079136 10:22110718-22110740 TGGGTGAGAGAGGAGGGGTTGGG - Intergenic
1067719772 10:48719616-48719638 GAGGAGAAACAGGAGGGGCTGGG + Intronic
1067850954 10:49753322-49753344 TAGGATAGAGAGGCAGGGCTAGG + Intronic
1071507749 10:86242930-86242952 TTGGTGAGGCAGGTGGGGCTGGG - Intronic
1073352897 10:102832410-102832432 TAGGTTGGCCAGCAGGGGCCGGG + Intronic
1075355408 10:121768450-121768472 TAGGTCAGAGAGGAGGGGCTGGG + Intronic
1080517283 11:33036239-33036261 TAGGTAAGAATGGAAGGGCTGGG + Intergenic
1083996363 11:66274977-66274999 CAGGTTAGAAGGCAGGGGCTGGG - Intronic
1084298132 11:68226339-68226361 TGCGTTAGGCAGGAGGGGCAAGG + Intergenic
1084360999 11:68668440-68668462 TGGGTAGGAAAGGAGGGGCTGGG - Intergenic
1085252586 11:75153335-75153357 TAGGGCAGACAGGTGGGGCGAGG + Intronic
1088820129 11:113449409-113449431 CAGGTGAGACAGGAAGGCCTTGG + Intronic
1088967405 11:114737785-114737807 TAAGTTAGATTGGAGAGGCTGGG + Intergenic
1089244007 11:117105176-117105198 AAAATTAGCCAGGAGGGGCTGGG + Intergenic
1091718237 12:2794951-2794973 TAGGTGGGTCAGGAGCGGCTCGG - Exonic
1091754416 12:3042338-3042360 TTGGTAAGACAGTGGGGGCTGGG - Intergenic
1092886720 12:12930795-12930817 TATGTCAGTCAGGATGGGCTGGG + Intergenic
1092933539 12:13339467-13339489 TGGTTTAGAGAGGAGGAGCTAGG + Intergenic
1093065640 12:14655453-14655475 TTGGATAGACATGAGGGGATTGG + Intronic
1096463558 12:51836217-51836239 CAGGGCAGACAGGCGGGGCTGGG - Intergenic
1097937803 12:65273090-65273112 CAGGTGAGACAGGAGGTGATTGG - Intergenic
1098470110 12:70833288-70833310 TAGGTTGGAAAGGTGGGTCTTGG + Intronic
1100268498 12:93001156-93001178 TCAGTTAGACAGGAGGAGCAAGG - Intergenic
1101499778 12:105292200-105292222 GAGGGTAGGGAGGAGGGGCTGGG + Intronic
1102700751 12:114837247-114837269 TATGTCAGTCAGGACGGGCTGGG - Intergenic
1104467980 12:129005549-129005571 TAGGTGAGGTAGGAGTGGCTTGG + Intergenic
1104467985 12:129005578-129005600 TAGCTGAGAGAGGAGTGGCTTGG + Intergenic
1105898572 13:24738845-24738867 CAGGTTAGATAGGAGGAGATTGG + Intergenic
1108321218 13:49292775-49292797 TAGGTTAGAGAGGGGTGGCCTGG + Exonic
1108643144 13:52401500-52401522 TATGTTAGCCAGGATGGTCTTGG + Intronic
1110595792 13:77319221-77319243 TAGGCGAGAGAGGAGGAGCTGGG + Intronic
1111646707 13:91040513-91040535 TATGTTGGCCAGGATGGGCTCGG - Intergenic
1112491310 13:99866884-99866906 TGGGAGAGAGAGGAGGGGCTTGG - Intronic
1112837996 13:103539581-103539603 TAGGTTAGACAGAAAGGGGAGGG + Intergenic
1114995933 14:28351793-28351815 TAAGTCAGACAGTAGGGACTTGG + Intergenic
1115795468 14:36930594-36930616 TAGATGATACAGCAGGGGCTGGG - Intronic
1116292048 14:43056591-43056613 TAGGGTAGAGAGGAAGGGATGGG - Intergenic
1117337900 14:54770361-54770383 TTGCTTAAACAGGTGGGGCTGGG + Intronic
1119753592 14:77098359-77098381 TAGGTGAGAAAGGGAGGGCTCGG + Exonic
1120030771 14:79638145-79638167 CAGGCTAGAAAGGAGGGGCATGG - Intronic
1120282347 14:82455082-82455104 TATGTTAGAAAGGAGAGGATTGG - Intergenic
1120296222 14:82645496-82645518 AAGCTTAGACAGGATGGGCTTGG - Intergenic
1120922046 14:89764174-89764196 TAGGGGAGGCAGGAGAGGCTGGG + Intergenic
1121025607 14:90613966-90613988 GAGGTTAAACACGAGAGGCTTGG + Intronic
1121721900 14:96115139-96115161 TAGGGCAGTCTGGAGGGGCTGGG + Intergenic
1122156186 14:99751806-99751828 GAGCTTAGACAGGAGGGGTTGGG + Intronic
1122553185 14:102561096-102561118 GAGGTGAGGCAGGATGGGCTAGG + Intergenic
1122687930 14:103518799-103518821 TAGGTGAGCCAGCGGGGGCTAGG - Intergenic
1129342055 15:74892568-74892590 GAGGGTGGACAGCAGGGGCTAGG + Intronic
1129389758 15:75214662-75214684 CAGGAGAGACAGGAGGGGCTTGG - Intergenic
1130440202 15:83945491-83945513 TAGGTCAGGCAGTGGGGGCTGGG + Intronic
1131735555 15:95327412-95327434 TGGGTTAAAAAGGAGGGGCGTGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1134673696 16:16074551-16074573 TAGGGCAGGAAGGAGGGGCTGGG - Intronic
1134955764 16:18381507-18381529 TAGGTGAGGGGGGAGGGGCTAGG + Intergenic
1136374879 16:29859422-29859444 TAGGTAGGAGATGAGGGGCTGGG - Exonic
1137532112 16:49284290-49284312 TAGGTTAGACATGGGGTTCTTGG - Intergenic
1140850760 16:78932793-78932815 TTTGTTCTACAGGAGGGGCTTGG - Intronic
1141034485 16:80615773-80615795 TGGATGACACAGGAGGGGCTGGG - Intronic
1143107050 17:4535172-4535194 AGAGTCAGACAGGAGGGGCTGGG - Intronic
1144199282 17:12924937-12924959 TAAGTAAGACAGGAGGGTTTTGG + Intronic
1146679659 17:34797932-34797954 TAGGTGGGACAGAAGCGGCTGGG - Intergenic
1152577971 17:81151273-81151295 TGGGGGAGACAGGTGGGGCTGGG - Intronic
1153193449 18:2568454-2568476 AAGGTTAGAAAGGAGTGGCTGGG + Intronic
1155067446 18:22280012-22280034 AAAATAAGACAGGAGGGGCTGGG + Intergenic
1159961526 18:74559074-74559096 AAGGTCAGGCAGGACGGGCTGGG - Intronic
1160077437 18:75691784-75691806 AAGGTGAGACAGTAGGGCCTGGG - Intergenic
1160787571 19:908238-908260 TGGGGTAGACAGGGGGGCCTGGG + Intronic
1162395668 19:10416988-10417010 GAGGTGCGAGAGGAGGGGCTTGG + Intronic
1162529475 19:11227615-11227637 GAGGCTTGACAGGAGGGGCGGGG + Intronic
1163756870 19:19111489-19111511 TAGGATAGACATGAGGCTCTGGG - Exonic
1165120178 19:33553777-33553799 TAGGGAAGTGAGGAGGGGCTAGG + Intergenic
1165172742 19:33905705-33905727 TAGGTTAGGCCAGAGGGGCCGGG - Intergenic
1166297642 19:41896841-41896863 TAGGTGAGAGAGGAGGGGGGAGG - Intronic
1166310177 19:41958408-41958430 GCGGTTAGACAGCTGGGGCTGGG + Intronic
1168075780 19:53980371-53980393 GAGGATAGAGAGGCGGGGCTGGG + Intronic
1168520158 19:57043697-57043719 GAGGTCAGTCAGGAGGGTCTGGG - Intergenic
927929343 2:27034143-27034165 TAGGTTCCACAGCAGGGGGTGGG - Exonic
934529085 2:95074086-95074108 AACGTTAGAGAGGAGGGCCTGGG + Intergenic
934620468 2:95800245-95800267 TATGTTAGCCAGGATGGTCTTGG - Intergenic
934812974 2:97299481-97299503 TATGTTAGCCAGGATGGTCTTGG + Intergenic
934824721 2:97408999-97409021 TATGTTAGCCAGGATGGTCTTGG - Intergenic
935388240 2:102523706-102523728 GAGGTGAGACTGGAGGGGCATGG - Intronic
937464655 2:122121319-122121341 TGTGTTAGACAGGATGGTCTCGG + Intergenic
937472349 2:122185080-122185102 TATGTTAGTCAGGCTGGGCTAGG + Intergenic
938156951 2:128949844-128949866 CAGGAAAGGCAGGAGGGGCTGGG - Intergenic
940189822 2:151028777-151028799 TAGGCTTGGCAGGAGGGTCTAGG - Intronic
945060133 2:205901520-205901542 TGTGTTAGTCAGGATGGGCTAGG - Intergenic
945741534 2:213668849-213668871 TGTGTTAGCCAGGAGGGTCTCGG + Intronic
947256600 2:228172608-228172630 TGGGTCAGGCAGGATGGGCTAGG + Intronic
947677103 2:231992205-231992227 TAGGTGAGACAGTAGGGGAGAGG + Intronic
947976873 2:234374274-234374296 CAGGTTACAGAGGAGGGGCGGGG + Intergenic
948259257 2:236590808-236590830 TAGGCTGTACATGAGGGGCTAGG - Intergenic
1169331938 20:4723010-4723032 AAGGGAAGACAGGAGGGCCTGGG - Intronic
1172668013 20:36614130-36614152 CAGGCTCGACAGGTGGGGCTGGG - Intronic
1172884345 20:38221313-38221335 TCGGATGGACAGGAGGGGCCTGG + Intronic
1174421151 20:50399925-50399947 CAGGTGAGAGAGGTGGGGCTGGG - Intergenic
1176252334 20:64131713-64131735 TAGGTGGGCCAGGAGGGGCTGGG + Intergenic
1179951563 21:44711503-44711525 CAGGGCAGACATGAGGGGCTTGG + Exonic
1181564518 22:23726810-23726832 TGGGTCATACAGCAGGGGCTGGG - Intergenic
1182191193 22:28462546-28462568 TAGGTTGGAAAGGTGGGGATGGG - Intronic
1182332291 22:29559781-29559803 TAGTTCAGGCAGGAGGGGATGGG - Intronic
1182466510 22:30520110-30520132 TGGGTCAGACAGGAGGCCCTGGG + Intergenic
1183498535 22:38164212-38164234 TAGGTCAGGCAGGAAGGGCCAGG + Intronic
1183659113 22:39208055-39208077 TGCGTGAGAGAGGAGGGGCTCGG - Intergenic
1183709497 22:39494545-39494567 TCAGTGAGACTGGAGGGGCTTGG + Intergenic
1185128194 22:49023300-49023322 CAGGGTAGACAGGAGGGGAGAGG + Intergenic
949881322 3:8663333-8663355 TATGTCAGACAGGAGGGGGTAGG - Intronic
950306816 3:11921640-11921662 TAGGTGAGACAGGAAGGGTGAGG + Intergenic
950735838 3:15007328-15007350 CATGTTAGACAGGATGGTCTCGG + Intronic
951837987 3:27003493-27003515 CAAGTTAAACAAGAGGGGCTGGG + Intergenic
954109748 3:48427473-48427495 GAGGCTAGATTGGAGGGGCTGGG - Intronic
954705877 3:52480272-52480294 TTGGTTAGAGAGGATGGGCTGGG - Exonic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
956767337 3:72494711-72494733 TAGGCTAGAGAGGACTGGCTGGG - Intergenic
958563977 3:95782927-95782949 TAGGTTAGATAGGAGAGGTTTGG + Intergenic
964140729 3:153396417-153396439 TAGGTTACACATGAAGGTCTTGG + Intergenic
965634314 3:170766195-170766217 AAGGGGAGACAGGAGTGGCTGGG - Intronic
968891387 4:3371066-3371088 TAGTTTAGAGATGAGGGGCATGG + Intronic
968975640 4:3820860-3820882 CAGGTGCGACAGGAGGGGCCCGG + Intergenic
969340497 4:6537751-6537773 TATGTTAGCCAGGATGGTCTCGG + Intronic
969827993 4:9773254-9773276 TAGGGTAGAGGGGAGGGGATGGG - Intronic
970309796 4:14770020-14770042 AAGGTTAGAAAGGAGGTGCAGGG - Intergenic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
972774987 4:42232148-42232170 AAGGTTAGAAATGATGGGCTGGG + Intergenic
972979114 4:44674219-44674241 TAGGTAAGACAGGCCGGGCGCGG - Intronic
978091895 4:104727368-104727390 TGGGTTACACAGGAGTTGCTGGG + Intergenic
980041942 4:127950174-127950196 TTTGTTAGACAGGAAGTGCTAGG + Intronic
981078727 4:140617245-140617267 TAGGTTAGAAATGCTGGGCTTGG - Intergenic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
987846199 5:23290439-23290461 TAGGTTGGACATGAGGGATTTGG - Intergenic
990738387 5:58888387-58888409 TAGGTTGAGCAAGAGGGGCTGGG - Intergenic
991243634 5:64486282-64486304 TGCGTTAGACAGGAGTGTCTGGG - Intergenic
991509648 5:67362601-67362623 TAAGTTATACAGGAGGCCCTAGG + Intergenic
994306357 5:98210070-98210092 TGAGTTAAACAGAAGGGGCTAGG - Intergenic
997778053 5:136629270-136629292 TAGGTCAGGAGGGAGGGGCTGGG - Intergenic
998297351 5:140984456-140984478 TGGGTTATACAAGAGGGGCTGGG - Intronic
1001604702 5:172951393-172951415 TAGGTTGGGCAGGAAGGGATGGG - Exonic
1002997149 6:2297518-2297540 TAGGGTATACAGGCTGGGCTGGG + Intergenic
1004086350 6:12453247-12453269 TGGAGTAGGCAGGAGGGGCTGGG + Intergenic
1005303566 6:24493579-24493601 TAGGTATCACAGGTGGGGCTGGG - Intronic
1005373036 6:25154769-25154791 TAGGGTATGCAGGATGGGCTGGG - Intergenic
1005844396 6:29766108-29766130 TAGGATTGACAGGAATGGCTTGG - Intergenic
1006107912 6:31727908-31727930 TAGGACAGATAGGAGGGGCTGGG - Intronic
1006382095 6:33704915-33704937 CAGGACAGACAGGAGGGGCATGG + Intronic
1008967287 6:57325587-57325609 TATGTTAGAAAATAGGGGCTGGG - Intronic
1010303638 6:74290174-74290196 TAACTGAGCCAGGAGGGGCTGGG + Intergenic
1013159355 6:107526364-107526386 TAGATTAGACAGGAGCTGATAGG - Intronic
1013345744 6:109258539-109258561 TACTTTAGGCAGGAGGGGATAGG - Intergenic
1015850324 6:137565355-137565377 TATGTTAGCCAGGATGGTCTTGG + Intergenic
1016382388 6:143498396-143498418 TAGGTAGGAAAGGAGGGGCCTGG + Intronic
1020085672 7:5308955-5308977 TGGGGGAGAGAGGAGGGGCTTGG + Intronic
1020112495 7:5455515-5455537 CAGGGAGGACAGGAGGGGCTGGG - Intronic
1021577307 7:22116178-22116200 ATGGCTAGACAGGGGGGGCTTGG + Intergenic
1022332618 7:29394661-29394683 TAGATTAGACAGTAGGGGCATGG - Intronic
1022467972 7:30664027-30664049 TAGGGTTGGGAGGAGGGGCTTGG - Intronic
1025208638 7:57008209-57008231 TGGGGGAGAGAGGAGGGGCTTGG - Intergenic
1025663309 7:63568669-63568691 TGGGGGAGAGAGGAGGGGCTTGG + Intergenic
1026672053 7:72399244-72399266 TAGGTTAGACAAAACCGGCTGGG - Intronic
1030913120 7:115277560-115277582 TAAGTTAGACAGGAGGGGAAGGG + Intergenic
1035995327 8:4540178-4540200 GAAGTTTGACAGGAGGGGCTGGG + Intronic
1036017991 8:4807485-4807507 TAGGTGATTCAGGATGGGCTGGG - Intronic
1038018820 8:23536188-23536210 TATTTAAGACAGGATGGGCTTGG - Intronic
1038726532 8:30087103-30087125 TAAAGTATACAGGAGGGGCTGGG + Intergenic
1041318934 8:56593818-56593840 TAGGTTAGGGAGAAGGGGGTTGG + Intergenic
1042773427 8:72403689-72403711 GAGGAAAGACAGGAGGGCCTGGG - Intergenic
1044762250 8:95533271-95533293 TAGATTAAAGAGGAGGGGCACGG + Intergenic
1047312598 8:123705156-123705178 TAGGTGAGACAGGCAGGACTTGG - Intronic
1049199548 8:141333312-141333334 GAGGTGAGGCTGGAGGGGCTGGG + Intergenic
1049709650 8:144057780-144057802 TAGGGCTGACAGGAGGGGCTGGG + Intronic
1050155508 9:2662790-2662812 TTGGTTAGAGAGGAGAGGCATGG - Intergenic
1052557709 9:30039140-30039162 TATGTTACACAGTAGGTGCTTGG - Intergenic
1053546343 9:39026920-39026942 CAGGTGAGACAGGATGGGGTGGG + Intergenic
1053810658 9:41848582-41848604 CAGGTGAGACAGGATGGGGTGGG + Intergenic
1054619935 9:67338857-67338879 CAGGTGAGACAGGATGGGGTGGG - Intergenic
1056006864 9:82281700-82281722 TAGGTAGGACAGGTTGGGCTGGG + Intergenic
1056563229 9:87751061-87751083 TAGGATAGCAAGGAGGGTCTAGG + Intergenic
1057795151 9:98150526-98150548 TAGTTTAGGCAGGATGGTCTGGG - Intronic
1060792708 9:126496968-126496990 TGGAGGAGACAGGAGGGGCTGGG + Intronic
1061772185 9:132934193-132934215 TAGGGAAGACGGGAGGTGCTTGG - Intronic
1061865535 9:133490200-133490222 AGGGCTAGACAGGAGGGTCTGGG + Intergenic
1062363280 9:136197508-136197530 CAGGCTGGAGAGGAGGGGCTGGG + Exonic
1185724043 X:2405114-2405136 TAGGGTAGAAAGGAGGAGATAGG + Intronic
1186070236 X:5811528-5811550 GAGGTGAGAGAGGAGGGGGTTGG - Intergenic
1186705556 X:12136675-12136697 TGTGTGAGAGAGGAGGGGCTCGG + Intergenic
1187188304 X:17009111-17009133 TAGAGAAGAGAGGAGGGGCTAGG - Intronic
1187330904 X:18338615-18338637 TAGGTTAGACAGGAGGGGCTGGG + Intronic
1190230769 X:48580261-48580283 TAGGTGGGATAGGAGGGGTTGGG - Intergenic
1190328221 X:49219591-49219613 GGGGTGAGGCAGGAGGGGCTAGG - Intronic
1190567311 X:51743793-51743815 TACGTTAGGCACGAAGGGCTTGG - Exonic
1200397868 X:156001805-156001827 TTGGCTAGAGATGAGGGGCTGGG - Intronic