ID: 1187332526

View in Genome Browser
Species Human (GRCh38)
Location X:18354233-18354255
Sequence CCCCAGCCCGGCCCTACCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 487}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187332507_1187332526 19 Left 1187332507 X:18354191-18354213 CCTCCTTCCTCCGCCCCGCCACC 0: 1
1: 0
2: 12
3: 149
4: 1504
Right 1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG 0: 1
1: 0
2: 4
3: 54
4: 487
1187332508_1187332526 16 Left 1187332508 X:18354194-18354216 CCTTCCTCCGCCCCGCCACCCAC 0: 1
1: 0
2: 8
3: 159
4: 2460
Right 1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG 0: 1
1: 0
2: 4
3: 54
4: 487
1187332509_1187332526 12 Left 1187332509 X:18354198-18354220 CCTCCGCCCCGCCACCCACCGTG 0: 1
1: 0
2: 8
3: 93
4: 1315
Right 1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG 0: 1
1: 0
2: 4
3: 54
4: 487
1187332518_1187332526 -6 Left 1187332518 X:18354216-18354238 CCGTGATGCCCCCCAGGCCCCAG 0: 1
1: 0
2: 11
3: 145
4: 824
Right 1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG 0: 1
1: 0
2: 4
3: 54
4: 487
1187332510_1187332526 9 Left 1187332510 X:18354201-18354223 CCGCCCCGCCACCCACCGTGATG 0: 1
1: 0
2: 2
3: 23
4: 289
Right 1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG 0: 1
1: 0
2: 4
3: 54
4: 487
1187332512_1187332526 5 Left 1187332512 X:18354205-18354227 CCCGCCACCCACCGTGATGCCCC 0: 1
1: 1
2: 1
3: 21
4: 257
Right 1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG 0: 1
1: 0
2: 4
3: 54
4: 487
1187332517_1187332526 -3 Left 1187332517 X:18354213-18354235 CCACCGTGATGCCCCCCAGGCCC 0: 1
1: 1
2: 0
3: 33
4: 290
Right 1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG 0: 1
1: 0
2: 4
3: 54
4: 487
1187332514_1187332526 1 Left 1187332514 X:18354209-18354231 CCACCCACCGTGATGCCCCCCAG 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG 0: 1
1: 0
2: 4
3: 54
4: 487
1187332513_1187332526 4 Left 1187332513 X:18354206-18354228 CCGCCACCCACCGTGATGCCCCC 0: 1
1: 1
2: 1
3: 24
4: 333
Right 1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG 0: 1
1: 0
2: 4
3: 54
4: 487
1187332516_1187332526 -2 Left 1187332516 X:18354212-18354234 CCCACCGTGATGCCCCCCAGGCC 0: 1
1: 0
2: 0
3: 26
4: 151
Right 1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG 0: 1
1: 0
2: 4
3: 54
4: 487
1187332511_1187332526 6 Left 1187332511 X:18354204-18354226 CCCCGCCACCCACCGTGATGCCC 0: 1
1: 2
2: 1
3: 12
4: 183
Right 1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG 0: 1
1: 0
2: 4
3: 54
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187332526 Original CRISPR CCCCAGCCCGGCCCTACCCA CGG Intronic
900144427 1:1151680-1151702 ACCCAGAACGGCCCCACCCAGGG + Intergenic
900146524 1:1161129-1161151 TCCCAGAGCGGCCCTGCCCAGGG + Intergenic
900162868 1:1232562-1232584 GCCCAGGCCGGCCGTGCCCACGG - Exonic
900164986 1:1240967-1240989 CCCCAGCCCGTTCTTGCCCAGGG + Intergenic
900215944 1:1481781-1481803 CCACAGGCCGGCCCTGCCCATGG - Intronic
900223082 1:1519835-1519857 CCACAGGCCGGCCCTGCCCATGG - Intronic
900344641 1:2205059-2205081 CCCAAGCCCCGCCCTTCCCCCGG + Intronic
900383446 1:2397454-2397476 GCCCAGCCTGGCCCTGCCCTGGG + Intronic
900528163 1:3139321-3139343 CCCCAGCCCTGCTCTTTCCATGG - Intronic
900788638 1:4665575-4665597 CCCCAGCCCAGTGCTCCCCAGGG - Intronic
900833368 1:4980743-4980765 CCCCATCCCTGCCTTACCCAAGG - Intergenic
900979011 1:6035621-6035643 CCCCAGCCCAGTTCTTCCCAGGG - Intronic
901373269 1:8818056-8818078 CGCCAGCCCGGCCCAGCCCGGGG - Intergenic
901510646 1:9716660-9716682 TCCCACCCAGGCCCTATCCAGGG - Intronic
902361788 1:15945950-15945972 CCCCAGCACACCCCTAGCCAAGG + Intronic
902689787 1:18103419-18103441 CCCCAGGCAGGCCCTGCCCCAGG - Intergenic
902955798 1:19923433-19923455 CCTGAGCCTGGCCCTACCGAGGG - Intronic
902984724 1:20148577-20148599 CCCCAGCCCAGCCCCAGGCATGG + Exonic
903283361 1:22262768-22262790 ACCAGGCCCGGCCCCACCCAGGG - Intergenic
903374102 1:22854947-22854969 GCCCAGCCCTGCCCTACACATGG + Intronic
903646114 1:24897397-24897419 GCCCTGCCCTCCCCTACCCACGG + Intergenic
904046653 1:27613186-27613208 CCCCACCCCAGCCCTACCCCTGG + Intronic
904601522 1:31675205-31675227 CCCCTTCCCTGCCCTTCCCAGGG - Intronic
904678421 1:32212607-32212629 GCCCAGCCCCTCCCTGCCCAGGG + Exonic
905284749 1:36871934-36871956 GCCCAGCCCGGCCTGACACAGGG - Intronic
905416718 1:37808744-37808766 CCCCACCCCAGCCCAGCCCAGGG - Intronic
905569225 1:38991057-38991079 CCCCACCCCCGCCCCTCCCAGGG - Intergenic
905777659 1:40679632-40679654 GCTCAGCCCTGCTCTACCCAAGG - Intergenic
905789840 1:40784075-40784097 CCCCAGCCCGGCGCCGCCCATGG + Exonic
905832766 1:41086553-41086575 CCCCTGCCCTGCCCTGCCCCTGG + Intronic
905886358 1:41494145-41494167 CCCCCACCCGGCACTCCCCAAGG + Intergenic
906038269 1:42766674-42766696 CCCCAGCCCGGCCCAGGCCTCGG - Exonic
907261323 1:53220658-53220680 CCCCGGCCCCGCCCTACTGAGGG - Intergenic
907429822 1:54405602-54405624 CCCCAGCCGGGCGCTCCCCGCGG - Intronic
907430241 1:54406953-54406975 CCCCAGCCCGCCCCGCCCCCGGG + Intronic
907466644 1:54642165-54642187 CCCCAGCCTGCCCTCACCCAGGG + Intronic
907477572 1:54715777-54715799 CCCCAGGCCGGCGGAACCCAAGG + Intronic
907517281 1:55000628-55000650 CCCCAGCCCTGCCCCCTCCACGG + Intronic
912707898 1:111928474-111928496 CCACAGCCAGGCCCCACCCCTGG - Intronic
913406883 1:118504251-118504273 CCCAAGCCCGGGCCTCCCTAAGG + Intergenic
914847083 1:151289278-151289300 GCCCAGCCCGGCCCTCCCCCGGG - Intronic
915094059 1:153446674-153446696 GCCCAGCCCAGCCCAGCCCATGG + Intergenic
915096839 1:153468988-153469010 CCCAAGCCCGCTCCCACCCAGGG - Intergenic
915552253 1:156642047-156642069 CCCCTGCCCCGCCCTCCCCGGGG - Exonic
915597400 1:156903457-156903479 CCCAGCCCAGGCCCTACCCAGGG - Intronic
916097314 1:161362798-161362820 CCCCAACCCGGCCCATCCCCAGG - Exonic
917969696 1:180198754-180198776 CCCCAGCCAGGGCCAGCCCAAGG - Exonic
921930202 1:220748572-220748594 TCCCAGCCCGGCCCTGGCCCAGG + Exonic
922176654 1:223202637-223202659 CCCCATCCCTGCTCTGCCCAGGG - Intergenic
922463259 1:225828921-225828943 GCCCAGCCCGGCCCGGCCCAAGG - Intronic
922573048 1:226644969-226644991 CTGCAGCCCAGCCCTTCCCAAGG - Intronic
922677515 1:227561650-227561672 CCCCTGCCCGCCCCTTCCCCCGG - Intergenic
922832168 1:228609568-228609590 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922832728 1:228611809-228611831 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922833289 1:228614050-228614072 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922833849 1:228616291-228616313 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922834406 1:228618532-228618554 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922834966 1:228620764-228620786 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922835517 1:228622967-228622989 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922836075 1:228625209-228625231 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922836633 1:228627448-228627470 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922837192 1:228629690-228629712 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922837753 1:228631931-228631953 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922838311 1:228634171-228634193 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922838869 1:228636396-228636418 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922839429 1:228638637-228638659 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922839990 1:228640868-228640890 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922840550 1:228643109-228643131 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922841113 1:228645340-228645362 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
922841658 1:228647561-228647583 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic
923086828 1:230708697-230708719 CCTCAGCCCCACCCCACCCATGG + Intronic
923192364 1:231631554-231631576 CACTAGCCTGGGCCTACCCAGGG - Intronic
923602850 1:235418915-235418937 ACCACGCCCGGCCCTCCCCAGGG - Intronic
923923382 1:238595485-238595507 CCCCAGACCAGCCCAACCCTAGG - Intergenic
1063268080 10:4476009-4476031 CACCAGCCAGGCCCTTCCCAGGG + Intergenic
1063417953 10:5889357-5889379 GCGCAGCCCGGCCCGACCCGCGG - Exonic
1066049617 10:31621582-31621604 CCCCAGCCCAGCCCTGCACAAGG + Intergenic
1067386045 10:45818503-45818525 GCCCAGCCAGGCCCCACTCATGG - Intergenic
1067449022 10:46369962-46369984 GCCCAGCCAGGCCCCACTCATGG + Intronic
1067468748 10:46521137-46521159 CCCCAGCCAGGCCCTTTCAAAGG + Intergenic
1067478013 10:46578949-46578971 CCCCAGCCCGTCCCTGGCCCAGG - Intronic
1067588347 10:47490803-47490825 GCCCAGCCAGGCCCCACTCATGG - Intronic
1067635472 10:47998894-47998916 GCCCAGCCAGGCCCCACTCATGG - Intergenic
1067785306 10:49241531-49241553 GCCCAGCCTGTCCCAACCCAGGG - Intergenic
1067801605 10:49362964-49362986 CCCCTGCCAGGCCGGACCCAGGG + Intergenic
1069158103 10:65054080-65054102 CCCCAGACTGGCCCTGCCCACGG - Intergenic
1069651770 10:70053995-70054017 CCCCAGCCCGGCCAGCCCCCCGG + Intronic
1069728051 10:70593852-70593874 CCCCAGCCCCTCCCTCCCAATGG - Intergenic
1070283554 10:75067601-75067623 GCCCAGCCCAACCCTACACAGGG - Intergenic
1070948445 10:80411861-80411883 GCCCAGCCCAGCCCCACCCAGGG - Intronic
1071504269 10:86223238-86223260 CTCCAGCCCTGCCCTGCGCATGG + Intronic
1072253625 10:93600854-93600876 CCCCATCCCCGCCCTCCCCGCGG - Intronic
1072665296 10:97388405-97388427 CACCAGCCCCGCCCTACCGCAGG + Intronic
1072765293 10:98089977-98089999 ACCCAGCCCCGCCCCACCAAGGG + Intergenic
1073097187 10:100987069-100987091 CCCGAGCCCGGCCCCACTCACGG + Exonic
1073750032 10:106515014-106515036 CCCCACCCCCGCCCTCCCCTTGG + Intergenic
1074465744 10:113679832-113679854 GCCCCGCCCGGCCCTACCCAGGG + Intronic
1074971283 10:118541432-118541454 CCCCAACCCTGCACTATCCAGGG + Intergenic
1075007196 10:118839579-118839601 CCCCAGCTGGGCCTGACCCAGGG - Intergenic
1075727583 10:124618369-124618391 CTGCAGCCCTGCCTTACCCAAGG - Exonic
1076612994 10:131737982-131738004 CCCCAGCCCGTCCTTTCCCCAGG - Intergenic
1076695629 10:132246034-132246056 CCCCACCCCGACACTGCCCAGGG + Intronic
1076719195 10:132385804-132385826 CCCAAGCCGGGCCTGACCCAAGG - Intergenic
1076776105 10:132699180-132699202 CCCCCGCCCTGCCCTTCCGATGG - Intronic
1076992947 11:285036-285058 CCGCAGCCCGGCCACCCCCACGG + Intronic
1077034447 11:488000-488022 GCCACGCCCGGCCCTGCCCACGG - Intronic
1077034469 11:488069-488091 GCCACGCCCGGCCCTGCCCACGG - Intronic
1077060332 11:615067-615089 CCCCAGCCCCGCCCCGCCCCGGG - Intronic
1077333960 11:1995099-1995121 CCCCAGCCCCCCTCTGCCCAAGG + Intergenic
1077343853 11:2037523-2037545 CCCCAGCCCACTCCTATCCAGGG - Intergenic
1077350346 11:2090332-2090354 CCCCATGCCCGCCCTCCCCATGG - Intergenic
1077416066 11:2424872-2424894 CCCCAGGCAGGACCCACCCACGG + Intergenic
1077421025 11:2450040-2450062 CCCCTGCTCGGCCCTAGGCAGGG + Intronic
1077433169 11:2526098-2526120 GCCCAGCCCGGCCCACCTCAGGG - Intronic
1077500863 11:2909280-2909302 CTCCAGCCCGGCCCTGCCCGGGG + Exonic
1077536549 11:3127416-3127438 CCCCATCCAGTCCCTGCCCAGGG - Intronic
1077547707 11:3182760-3182782 CCCCTGCCCCGCCATAGCCAAGG - Intergenic
1078058968 11:8031528-8031550 TCCCTGCCAGGCCCAACCCATGG + Intronic
1081115309 11:39192692-39192714 CCTCAGCCCGAGCCTCCCCAAGG - Intergenic
1081506413 11:43721668-43721690 CCCAAGCCCAGGCCCACCCATGG - Intronic
1083745671 11:64735366-64735388 CTCCACCCCCACCCTACCCAGGG + Intronic
1083769008 11:64856076-64856098 TCCCAACCCGGCCCTAAGCAAGG + Intronic
1084165187 11:67372276-67372298 TCCCAGCCTGGCCCTCCCCCCGG - Intronic
1084190114 11:67494884-67494906 CTACAGCCCGGCCTTCCCCAGGG - Exonic
1084214756 11:67641192-67641214 TCCCAGCCTGGCCCTCCCCTGGG - Intergenic
1084310369 11:68312993-68313015 CCCCACCCGGGCCCTCCCCGGGG + Intronic
1084416062 11:69033645-69033667 CCCCAGCCCCGCCCGACCTCAGG + Intergenic
1084441165 11:69174161-69174183 CCCCAGTCCCACCCTACACAAGG - Intergenic
1084494693 11:69497184-69497206 CCCCCGCCCCGCCCTGCCCCAGG + Intergenic
1084603576 11:70160346-70160368 GCCCTGCCCCGCCCTGCCCAGGG - Intronic
1084951825 11:72670719-72670741 CCCCAGCCTGGCCCTACTTCAGG + Intronic
1084953442 11:72679080-72679102 CCCATGCCAGGCCCTACCCAAGG - Intergenic
1085049713 11:73374009-73374031 CCCCAGCCAGGCCCTGCCTGGGG - Intergenic
1085512823 11:77096888-77096910 CCCCTCCCAGGCCCCACCCAGGG - Intronic
1085523313 11:77150623-77150645 CCCCACCCCGTCCCTCCACAGGG - Intronic
1088903048 11:114133283-114133305 CCCCAGCCCTGCCCCACCCCTGG + Intronic
1089254671 11:117187949-117187971 CCCCACCCCAGGTCTACCCATGG - Intronic
1089395757 11:118135672-118135694 CGCCAGCCCTCCCCTCCCCAGGG - Exonic
1089443787 11:118535529-118535551 CCCCAGCCCTGACCAACCCATGG + Exonic
1089596936 11:119586387-119586409 CCCCAGCCCGGGGCTACCCTTGG + Intergenic
1089979174 11:122758162-122758184 CCCCAGACCGGCCCCACCCCCGG - Intronic
1090265333 11:125349966-125349988 TTCCAGCCTGGCCCTTCCCAGGG - Intronic
1090472968 11:126996461-126996483 CCCCAACCCTGCCCCTCCCAAGG + Intronic
1090788400 11:130069688-130069710 CCCCCGCCCGGCCCCGCCCCCGG - Intergenic
1202816943 11_KI270721v1_random:50281-50303 CCCCAGCCCCCCTCTGCCCAAGG + Intergenic
1202826839 11_KI270721v1_random:92712-92734 CCCCAGCCCACTCCTATCCAGGG - Intergenic
1091746848 12:2998349-2998371 CCACAGCCCGGCGCTTCCCCAGG - Intronic
1091792698 12:3280848-3280870 CCCCTGCCGGCCCCTCCCCAGGG - Intronic
1091828882 12:3535342-3535364 CCCCAGACTGGCCTTACCCAGGG - Intronic
1091985871 12:4909985-4910007 CCCCAGCGCGGACCTCGCCAAGG - Exonic
1092120219 12:6038428-6038450 CCCCAGCCCGGCCTGCCCAAGGG - Intronic
1094818202 12:34206154-34206176 CCCCTGCCCGCCCCTTCCCCAGG - Intergenic
1095227070 12:39689983-39690005 CCCCATACCTGCTCTACCCAAGG - Intronic
1096114931 12:49050251-49050273 CCCCAGCCCTGCCCCAGCCCTGG - Exonic
1096514303 12:52147757-52147779 CCCCCTCCAGGCCCTAACCAGGG - Intergenic
1096519432 12:52175883-52175905 CCCCAGCCAAGCCCCAGCCAGGG - Intronic
1096583122 12:52601198-52601220 CCCCAGCCCGGCGCTGCCGAAGG + Exonic
1096796759 12:54082598-54082620 CCCCAGCCCGGCCCCGGCCCCGG - Intergenic
1097173488 12:57129651-57129673 CCCCAACACAGCCCTACCCCAGG - Intronic
1097233311 12:57524984-57525006 CCCCACCCCAGCCCCACCCGGGG - Exonic
1097664787 12:62466713-62466735 CCCCAGCCCCGCCCCGCCGACGG + Intergenic
1101654056 12:106704554-106704576 CCTCAGCCTGGGCCTGCCCAGGG - Intronic
1102525978 12:113512598-113512620 CCCCTGCCTAGCCCTATCCAGGG - Intergenic
1103703716 12:122860532-122860554 CCCCTGCCCCCCCCCACCCAGGG - Intronic
1104869741 12:131986542-131986564 ACCCTGCCCCGCCCTGCCCACGG + Exonic
1104897273 12:132170566-132170588 GCCCAGCCAGGGCCTGCCCAAGG - Intergenic
1104924357 12:132306229-132306251 CACCTGCCCGGGCCTCCCCACGG + Intronic
1107907243 13:45072549-45072571 TCCCAGCCCAGCCCTGCCCCGGG + Intergenic
1108643951 13:52408205-52408227 CCCGAGCCCTGCCCTGCTCAGGG + Intergenic
1112041410 13:95552358-95552380 CCCCCACCCAGCCCTACCCAAGG - Intronic
1113027832 13:105960455-105960477 GCCCAGTCCGGCCCTTGCCAGGG - Intergenic
1113380007 13:109795664-109795686 CCCCAACCCGTCCCTTCCCCAGG - Intergenic
1114484661 14:23055644-23055666 CCCCAGCCCGGGCCTGGGCAGGG - Exonic
1114736275 14:25047219-25047241 CACCAATCCGGCACTACCCAAGG + Intronic
1117279972 14:54230079-54230101 CCCCAGAGCAGCCCTACACAGGG - Intergenic
1118309562 14:64682413-64682435 GGCCAGCCCTGCCCTGCCCACGG - Intergenic
1119474685 14:74920255-74920277 CCCCACCCTGTCCCTTCCCAGGG - Intronic
1120859344 14:89240867-89240889 GCCAGGCCCGGCCCTACCCCTGG - Intronic
1122115001 14:99523190-99523212 CCCCAGCCCAGCCCCAGCCTGGG - Intronic
1122969445 14:105146570-105146592 CCCCAACCCGCCCCAACCCAGGG + Intronic
1122976429 14:105172734-105172756 GCACAGCCTGGCCCTGCCCATGG + Intergenic
1122983180 14:105200662-105200684 CCACCTCCCGGCCCCACCCAGGG + Intergenic
1123716740 15:23039308-23039330 CCCCAGCGCGCCCCGACCCCGGG + Intronic
1124374719 15:29122700-29122722 CCATAGCCCGGCCCCCCCCAGGG - Exonic
1125318771 15:38459586-38459608 CCCCAGCCCAGCCCAGACCATGG - Intronic
1125671785 15:41478892-41478914 GCCCAGCCAGGCCCTAGCTAAGG - Intronic
1125722762 15:41853048-41853070 CTCCAGCCCTGCCCTGCCCATGG - Intronic
1125745907 15:41997033-41997055 CCCAGGCCCTGCCCTACCCCAGG - Intronic
1126093914 15:45074286-45074308 CCCCAGCCCACCCCTAAGCATGG + Exonic
1126697960 15:51341652-51341674 GCCAAGCCCTGCCCTGCCCAAGG + Exonic
1127071340 15:55290299-55290321 CCCAGGCCCGGCCCTGCCCCCGG + Intronic
1128144826 15:65327218-65327240 CCCCAGCCGCACCCTTCCCAAGG + Exonic
1128676120 15:69609928-69609950 TCCCTGCCCGGGCCTTCCCACGG - Intergenic
1129462227 15:75705126-75705148 CCCCTGCCTGGCCCTCCCCAGGG - Intronic
1129663056 15:77563983-77564005 GCCCAGCCCAGCCCAGCCCACGG + Intergenic
1129722634 15:77886722-77886744 CCCCTGCCTGGCCCTCCCCAGGG + Intergenic
1129884733 15:79030260-79030282 TCCAGCCCCGGCCCTACCCAGGG - Intronic
1130627085 15:85526708-85526730 CCCCAGCCTGGCCCTGCCCCTGG + Intronic
1131522887 15:93129742-93129764 CACTAGCCAGGCCCTACCCTAGG - Intergenic
1132549284 16:547663-547685 CCCCAGCCCAGCCCGAGCCCTGG - Exonic
1132639461 16:971054-971076 TCCCTGGCCGGCCCTGCCCACGG + Intronic
1132657756 16:1048467-1048489 CCCCAGCCAGGTCCCATCCAGGG + Intergenic
1133020140 16:2963554-2963576 CCCCTGCCCCGCCCTTCCCTGGG - Intergenic
1133022146 16:2971446-2971468 CACCCGCCCTTCCCTACCCATGG - Intronic
1133269843 16:4605504-4605526 CCCCAGCCCTGCCCTCCCCAAGG + Intergenic
1133303149 16:4795335-4795357 AACCAGCCCCGCCCTCCCCAGGG - Intronic
1133390194 16:5403978-5404000 GCCCAGCCCCACCCTTCCCATGG - Intergenic
1133969736 16:10559094-10559116 CACCAGCCCGGCCCTCCCCAGGG - Intronic
1135995499 16:27244694-27244716 CCCCAGGCCCGCTCTACCGAGGG + Intronic
1136145082 16:28311844-28311866 ATCCAGCCCAGCCCTTCCCAGGG + Intronic
1138383039 16:56617079-56617101 CCCCAGCTCAGGCCTACCCAGGG + Intergenic
1138536603 16:57663648-57663670 CCCGAGCCCGGCCCAGCCCCAGG + Exonic
1139799830 16:69513605-69513627 CCTCAGCCCAGCCCCACCCCTGG + Intergenic
1139949161 16:70660870-70660892 GCCCAGCCCAGCCCAGCCCAGGG + Intergenic
1140221391 16:73047217-73047239 CCCCACCCCGCCCCTGCCCAAGG + Intronic
1140599221 16:76455340-76455362 CCTCTGCCAGGCCCTGCCCATGG - Intronic
1140866525 16:79067124-79067146 CCCCAGACAGGCCCTAGACAGGG - Intronic
1141205288 16:81928680-81928702 CCTCAGCCCCGCCCTACACAGGG + Intronic
1141432992 16:83980556-83980578 CCCCAGCTTGGCCCTCCCCTTGG + Intronic
1141531563 16:84649584-84649606 TCCCACCCCGGCCCTCCCCTAGG - Intronic
1141555916 16:84836721-84836743 CCCCACCCCGGCCCCACCCGAGG + Intronic
1141564423 16:84891760-84891782 CTCCATCCCTGCCCTCCCCAGGG - Intronic
1141712496 16:85708129-85708151 CCCCAGCCCTGCAGTTCCCAGGG - Intronic
1141814568 16:86400813-86400835 CCCCACCCAGTCCCTTCCCAAGG - Intergenic
1141989884 16:87603536-87603558 CCCCGGCCCGGCCCGGCCCGCGG - Intronic
1142028804 16:87828351-87828373 CCCCACCCCGGGTCTACCTAGGG - Intergenic
1142140801 16:88471923-88471945 CCCCTGCCCCGGCCCACCCAAGG - Intronic
1142281488 16:89150501-89150523 CACCAGGCCGCCCCTGCCCAGGG + Intronic
1142712408 17:1730631-1730653 GCCCAGCCTGGCCCTACCCAAGG - Intronic
1142749260 17:1977734-1977756 CCCCATCCCGGCCCTCACCGAGG + Intronic
1142807859 17:2380828-2380850 GCCCAGCCCAGCCCTGCCCCCGG + Exonic
1144454747 17:15409397-15409419 TCCCTGCCCTGCCCTACGCAGGG - Intergenic
1144606144 17:16667066-16667088 CCCCGGACTGGCCCTGCCCACGG + Intergenic
1144720014 17:17462633-17462655 CCCCAGCTGGGCCCCAGCCATGG - Intergenic
1144786654 17:17836044-17836066 CCCCAGCCTCGCTCCACCCAAGG + Intronic
1145059731 17:19724914-19724936 CCCCGGACAGGCCCTGCCCACGG + Intergenic
1146506007 17:33405979-33406001 CCCCTGCCCTGCCTTTCCCATGG + Intronic
1147244433 17:39110824-39110846 CCCCAGCCTGCCCCAACCCCAGG - Intronic
1147911951 17:43861269-43861291 CCTCAGCCCCTCCCTTCCCAGGG - Intronic
1148437800 17:47696094-47696116 CCGCGGCCCGGCCCTCACCATGG + Exonic
1148547563 17:48529483-48529505 CCCCAGTCCAGCCCTATCCCAGG - Exonic
1149849917 17:60028238-60028260 CCCCAGCCCTGCCCCTCCCTGGG - Intergenic
1149860251 17:60118286-60118308 CCCCAGCCCTGCCCCTCCCTGGG + Intergenic
1150436010 17:65154822-65154844 CCCAAGCCCGGGCCTCACCACGG + Intronic
1150657143 17:67046652-67046674 GCCCTGCCCTGCCCTGCCCAGGG - Intronic
1150883997 17:69064094-69064116 CCCCTTCCCTGCCCTGCCCATGG - Intergenic
1151540034 17:74760119-74760141 TCCCAGCCAGGCCCTCCCCCGGG - Intronic
1151719560 17:75847536-75847558 CCCCACCACCGCCCTACCCTGGG - Exonic
1151882765 17:76904960-76904982 CCCCAGCCCAGCTCTAACCATGG - Intronic
1151942585 17:77301918-77301940 CCCCATCCCTGCTCTGCCCAGGG + Intronic
1152070788 17:78132683-78132705 CCCCTGCCCAGGCCTCCCCAGGG + Intronic
1152103163 17:78314434-78314456 CCGCAGCCACGCCCTGCCCAGGG + Intergenic
1152146233 17:78570433-78570455 TCCCAGCCCTTCCCTTCCCATGG + Intronic
1152546773 17:81004196-81004218 GCCCAGCCCAGCCCTTCCCGGGG + Intronic
1152564250 17:81093077-81093099 GCCCAGCCCAGCCCAGCCCAGGG - Intronic
1152898763 17:82928283-82928305 CTCCTGCCCGGCCCTACCCCGGG - Intronic
1154139587 18:11811206-11811228 CCCCAGCGCAGCCCTCCCCACGG + Intronic
1154255560 18:12778029-12778051 CCCGAGCCCGGCCGCCCCCACGG - Intergenic
1155395982 18:25387328-25387350 CCCCACCCCATCTCTACCCATGG + Intergenic
1157286794 18:46382372-46382394 ACCCAGCCAGGACCAACCCAGGG - Intronic
1157685363 18:49638876-49638898 CCCAACCCAGTCCCTACCCAGGG - Intergenic
1158435896 18:57435534-57435556 CCCCACCCCGCCCCCACCCCGGG + Intergenic
1159472921 18:68880126-68880148 CCCGAGCCCTGCCCCGCCCAAGG + Intronic
1159948003 18:74457865-74457887 ACCCAGCCCTCCCCTTCCCACGG + Intronic
1160745624 19:709631-709653 CCCCACCCCCGCCCTTCCCAAGG + Intronic
1160795312 19:942586-942608 CCCCAGCCCAGCCCTGACCAAGG - Intronic
1160826421 19:1082449-1082471 CCCCAGTCCCGCCCTTCCCCGGG - Intronic
1160841142 19:1147536-1147558 GCCCAGCCCGGCAGGACCCATGG + Intronic
1160916155 19:1497600-1497622 CTCCAGCCCGGTCTCACCCATGG + Exonic
1161073446 19:2273709-2273731 CCCCAGCCTGGGCCTGCGCATGG + Intronic
1161210531 19:3062971-3062993 CCCCCGCCCCGCCCCACCCCAGG - Exonic
1161221732 19:3120938-3120960 CCCCAGCCCGGCCCAGGGCAAGG - Intronic
1161276901 19:3423514-3423536 CCCCTCCCCAGCCCCACCCATGG - Intronic
1161588874 19:5119707-5119729 CCCCAGCCGTACCCTCCCCAGGG - Exonic
1161596403 19:5153184-5153206 CCCGACCCCGGCCCTCTCCAGGG - Exonic
1161915147 19:7222756-7222778 CTACAGCCTGGCCCTCCCCAAGG - Intronic
1162158264 19:8694554-8694576 ACCCAGCCGGGCTCTCCCCAAGG - Intergenic
1162345434 19:10115584-10115606 CCCCATCCCGCCCCTCCACAGGG - Exonic
1162352466 19:10158852-10158874 CCCCACCCCGGCCATCCCCTCGG + Intronic
1162372687 19:10288772-10288794 CCCCACCCCGCCCCTGCCCGTGG - Intergenic
1162475895 19:10899203-10899225 CCCAAGCCCAGCCCTAGCCCTGG + Intronic
1162821226 19:13224833-13224855 GCCGCGCCCGCCCCTACCCAGGG + Intronic
1162909247 19:13840549-13840571 ACCCAGCCCTGCTCTGCCCAGGG + Intergenic
1163433459 19:17281978-17282000 CCCCGGCCCCGCCCTCACCACGG - Exonic
1163551787 19:17969550-17969572 CCCCACCCCCTCCCTGCCCAGGG + Intronic
1163666679 19:18606853-18606875 CCCCGGCCCGGCCCGGCCCCGGG + Intronic
1163785608 19:19273393-19273415 CCCCTCCCCGGCCCTCCCCCTGG + Intergenic
1164402146 19:27909873-27909895 CCCCAGCGCTGTCCTACCCCCGG + Intergenic
1164615528 19:29665166-29665188 CCCCACCCCACCCCTGCCCAAGG + Exonic
1165795916 19:38519079-38519101 CCCCAGCCTGACCCTAACCTTGG - Intronic
1165908802 19:39211067-39211089 CCCCACCCCAGCCCTACTCTGGG + Intergenic
1166295840 19:41888861-41888883 ACCCAGCCCTGCCCTCACCAGGG - Exonic
1166528409 19:43527247-43527269 CCCCCGCCCCGCCCTTCCCGGGG - Intronic
1166547201 19:43640459-43640481 CCCCAGCCTCGCCCTGCCCTGGG - Intergenic
1166695198 19:44847926-44847948 TCCCAGCCCCTCCCTCCCCAGGG - Intronic
1166705644 19:44906519-44906541 CCCCAACCCGGCCTCACCCCAGG - Intronic
1166802769 19:45468514-45468536 CCCCAACCCGGCCATAGCCTTGG + Exonic
1167743977 19:51340374-51340396 CCCCAGCCCGCTTCTCCCCAAGG + Intronic
925348716 2:3187463-3187485 CACCAGCACGCCCCTCCCCACGG + Intergenic
925988558 2:9235383-9235405 CCCCAGCCCTTCCCTTTCCAGGG + Intronic
927207817 2:20621128-20621150 CCCCTGCCCGGCCCTGCCCCAGG - Intronic
927508336 2:23628876-23628898 GCCCACCCCCGCCCTCCCCAGGG - Intronic
928238810 2:29568962-29568984 CCCCCGCCCTGTCCCACCCAAGG - Intronic
929380908 2:41352181-41352203 ACCCAGACCCGCCCTCCCCATGG - Intergenic
931763476 2:65435803-65435825 CCCCACCCCGGCCCTTCCCGCGG + Intergenic
932261218 2:70329296-70329318 CCGCTGCCCTGCCCTGCCCATGG + Intergenic
932337447 2:70939088-70939110 CCCCATCCCGGCCTCACGCATGG + Intronic
932492671 2:72131967-72131989 CCCCTGCCACGCCCTTCCCAGGG + Exonic
932976156 2:76602305-76602327 CCCCAGCCCTGCCCTAGCAGAGG + Intergenic
933724384 2:85418434-85418456 CCCCAACCCGGCCCCAGCCTGGG + Intergenic
933749810 2:85596026-85596048 CCCCAGGCCGGCCCAACGGACGG - Intronic
934514954 2:94980824-94980846 CCACAGACCTGCCCTGCCCAGGG - Intergenic
934649650 2:96083641-96083663 CCCAGGCCCTGCCCTACCCCAGG + Intergenic
934736918 2:96694238-96694260 CCCCTGCCAGCCCCTACCCATGG + Intergenic
937291668 2:120785631-120785653 CCCAAGCCCAGCACCACCCATGG + Intronic
937914141 2:127090659-127090681 CACCAGCCCAGCCCCAGCCAGGG + Intronic
937987593 2:127645449-127645471 CCCCAGCCCGGAGCCACCCCAGG + Intronic
938414449 2:131093051-131093073 CCCCCGCCCGGCCTTGCCCGCGG + Intronic
938734613 2:134175037-134175059 CCACAGCCCCACCCTGCCCATGG - Intronic
940004604 2:148999242-148999264 CCCCACCCCCACCCCACCCAGGG + Intronic
941877181 2:170445935-170445957 CCCGACCCCTGCCCAACCCAGGG - Intronic
946310021 2:218878137-218878159 CCCCACCCTGGCCCTGCCCTGGG - Intergenic
947518786 2:230828619-230828641 CCCCGGGCTGTCCCTACCCAAGG + Intergenic
948364584 2:237446345-237446367 CTCCAGTCCTGCCCTCCCCATGG + Intergenic
948466865 2:238156482-238156504 CCCCACGCCGGCTCTGCCCATGG + Intergenic
948467135 2:238158067-238158089 CCCCAGCCCCACCCTACCCCTGG - Intergenic
948503542 2:238411779-238411801 ACCCAGGCTGCCCCTACCCAGGG + Intergenic
949023644 2:241754967-241754989 CCCCTGCAGGGTCCTACCCAGGG - Intronic
1169937978 20:10905113-10905135 GGCCAGCCCGCCCCTACTCAAGG - Intergenic
1170770718 20:19330197-19330219 CCTCAGCCCAGCCCTGCCCAGGG - Intronic
1171823283 20:29874507-29874529 CCCCTGCCCGCCCCTTCCCCCGG - Intergenic
1171848205 20:30290587-30290609 CCCCAGGCCGGCCCCGCCCCCGG - Intergenic
1172032843 20:31993886-31993908 CCCCATCCCGGCCCCAACCCGGG - Intronic
1172118711 20:32585487-32585509 CCCCCGCCCGGCCCGGCCCCTGG + Intronic
1172753897 20:37270104-37270126 CCCAAGCCCAGCCCTGCCCCAGG + Intergenic
1172768076 20:37361598-37361620 CGCCAGCCGGCCCCTGCCCATGG - Intronic
1173176266 20:40767225-40767247 CCCCAGCCCATCCCTATCCTAGG + Intergenic
1173708775 20:45136220-45136242 CCCCTGCCCTACCCTTCCCATGG + Intergenic
1174611261 20:51800730-51800752 CCCCACCCCGCCCCCAACCAAGG + Intronic
1175319491 20:58075169-58075191 CCCCAGCCCGGGGGTGCCCAGGG + Intergenic
1175400775 20:58698792-58698814 CCCCAGCCTGGTCCCACCCCCGG - Intronic
1175800416 20:61798179-61798201 GCCCCGCCCGGCCCTGCCCCGGG + Intronic
1176054915 20:63140047-63140069 CCCCGCCCCGGCCATAGCCACGG - Intergenic
1176062972 20:63180243-63180265 CTCCAGCCTGGCCCTTCCCTCGG + Intergenic
1176131837 20:63499542-63499564 CCCCTCCCCGGCCCTGCTCATGG + Intergenic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
1176237356 20:64059809-64059831 CCCCAGGCCGGCCCAACCAGTGG - Intronic
1176286632 21:5022281-5022303 CCCCACCCCTGCGCTTCCCAGGG + Intergenic
1179177846 21:39021705-39021727 CCCCAGCTCAGCCCTCCACAGGG - Intergenic
1179190582 21:39118890-39118912 GCCCTCCCCGGCCCTACCCAGGG + Intergenic
1179247262 21:39644838-39644860 CCCCAGCACTGGCCTCCCCAGGG + Intronic
1179794662 21:43776077-43776099 CCACAGCCCGGGCCAGCCCAGGG + Intronic
1179870549 21:44241194-44241216 CCCCACCCCTGCGCTTCCCAGGG - Intergenic
1180701869 22:17785602-17785624 CCCCACCCTGGCCCCACCCTGGG + Intergenic
1180783664 22:18535355-18535377 AGCCAGCACGGCCCTGCCCATGG - Intergenic
1180960306 22:19759414-19759436 GCCCAGCCCAGCCCAGCCCACGG - Intronic
1181030646 22:20147556-20147578 CCCCCACCCAGCCCAACCCACGG - Exonic
1181127234 22:20709406-20709428 AGCCAGCACGGCCCTGCCCATGG - Intronic
1181172098 22:21015558-21015580 CCCCACCCAGGCCCCACCCAGGG + Intronic
1181240567 22:21474707-21474729 AGCCAGCACGGCCCTGCCCATGG - Intergenic
1181483946 22:23218918-23218940 TCGCAGCCCGGCCCTGCTCAGGG + Intronic
1182455638 22:30448445-30448467 CCCCAGCCAGGCCAAACCCCAGG + Intronic
1183172257 22:36197151-36197173 GCCCAGCCCAGCCCTTCCTAAGG + Intronic
1183181001 22:36259593-36259615 CCCCAGCCCAGCCCTTCGTAAGG - Intronic
1183208253 22:36433811-36433833 CCCCAGCCCGCCCCTCCCGCTGG - Intergenic
1183303263 22:37068984-37069006 CCCCAGCCCCGCCCTTCTCCAGG + Intronic
1183614774 22:38937266-38937288 CCCCAGCCCAGGGCTTCCCACGG + Intergenic
1183650830 22:39152466-39152488 CCCCGGCCCGGCCCGGCCCCGGG - Exonic
1183951278 22:41354464-41354486 CCCCAGCATTGCCCTGCCCAGGG - Intronic
1184241361 22:43212715-43212737 CCCCACCCCGTCCCCACCCCAGG - Intronic
1184349127 22:43932006-43932028 CCCCAGCCCGCCCTTCCACACGG - Intronic
1184551884 22:45209055-45209077 CCCCAGTCCAGCCTTTCCCAGGG - Intronic
1184750623 22:46484316-46484338 CACCAGCCCAGCCCAGCCCATGG + Intronic
1184764458 22:46564285-46564307 CCTCAGCCCCACCCCACCCAAGG + Intergenic
1185055012 22:48575090-48575112 CCCCAGCCGGGCCCGACCAGCGG - Intronic
1185069303 22:48647537-48647559 CCACAGCCGGGACCTCCCCAAGG + Intronic
1185246441 22:49775676-49775698 CACCATCCCGGCCCCACCCCTGG - Exonic
1185376195 22:50483607-50483629 ACCCAGCCCTGCCCTGCCCTGGG - Exonic
1185381163 22:50508018-50508040 ACCCCGCCCCGCCCGACCCACGG + Intergenic
949252161 3:1998570-1998592 CGCCAGCCTAGGCCTACCCAGGG + Intergenic
950186706 3:10949881-10949903 CTCCATCCCGCCCCTACCAAGGG - Intergenic
950345220 3:12287563-12287585 CCCCAGACCGGCCCTGGCCGGGG + Intronic
950495541 3:13331894-13331916 CCCCACCCCAGACCTGCCCAGGG - Intronic
950510032 3:13420417-13420439 CCCCAGCCCGGCCCTCGCGCAGG + Intergenic
953391276 3:42535274-42535296 CCCCAGCCCTGCCCCACCCCTGG - Intronic
953582243 3:44167600-44167622 CTCCAGCTCCGCCCTTCCCAAGG - Intergenic
953748639 3:45593829-45593851 CCTCAGCCCGGCCCCGCCCCTGG - Intronic
953901216 3:46845299-46845321 CCGCACCCCAGCCCTGCCCAGGG - Intergenic
953907363 3:46874979-46875001 CCCCAGCCCTGCTGTTCCCAAGG - Intronic
954275560 3:49539687-49539709 CCCCAGCCCGAACCTGCCCAAGG - Intergenic
954449000 3:50561657-50561679 GCCCAGCCCAGCACTCCCCATGG + Intronic
955071281 3:55574511-55574533 CCCCATCCCAGCTCTTCCCAAGG - Intronic
955228431 3:57079300-57079322 CCCCGGCCCCGCCCAGCCCAGGG - Exonic
959933209 3:112004255-112004277 CCCCACCCCTGCCCTTTCCAGGG - Intronic
960958762 3:123054291-123054313 TCCCAGCCCTGCCCTTTCCAAGG + Intergenic
961349444 3:126290358-126290380 CCCCAGCCCAGCCCAGCCCCTGG + Intergenic
961453450 3:127013001-127013023 CCCCATCAAGGCCCTCCCCAGGG - Intronic
961508738 3:127388475-127388497 CCCCAGCCTGGGCCTGGCCAAGG + Intergenic
961723789 3:128912629-128912651 CTACCGCCCGCCCCTACCCATGG + Exonic
961764366 3:129197489-129197511 CCCCAGCCCTGCACTCCCTAGGG - Intergenic
961821943 3:129579603-129579625 CCCCAGTCCTGCCCTGCTCATGG - Intronic
961862249 3:129926312-129926334 CCCCAGCCCTACCCCACCGAGGG - Intergenic
962452485 3:135532136-135532158 CCCAAGCCACTCCCTACCCAAGG - Intergenic
962919896 3:139941210-139941232 CCCCAGCTCAGGCCTCCCCATGG - Intronic
968199382 3:196739745-196739767 CCCCCGCGCGGGCCTGCCCATGG + Intergenic
968478587 4:824299-824321 CCCCAGCCCGGCCCTTTTCGAGG - Intronic
968504430 4:965373-965395 CCCCAGCCCAGGGCTGCCCAAGG + Intronic
968542745 4:1176077-1176099 CCCCAGCCCGATCCAACCCAAGG - Intronic
969208994 4:5672028-5672050 CCAGAGCCAGGCCCTACTCAAGG + Intronic
969324498 4:6433384-6433406 CTCCAGCCCCGCCCTACACTTGG + Intronic
969630481 4:8333021-8333043 CCATGGCCCAGCCCTACCCAGGG + Intergenic
969723495 4:8906242-8906264 CTCCAGCCCGGCCCCTCCCCAGG + Intergenic
969855372 4:9994900-9994922 CCCAAGCCAGACCCTGCCCATGG - Intronic
970616711 4:17774455-17774477 CCCCAGCCCTGCCCTGCCTCTGG - Intronic
971207342 4:24583869-24583891 CCCCACCCAGGCCCTCCCCACGG + Intronic
972770263 4:42191095-42191117 CCCCAGCCCGGCCAGTCACATGG + Intergenic
974543869 4:63275272-63275294 CCCCAGCCTGGCCATGCCTATGG + Intergenic
980595825 4:134952929-134952951 CCTCGGCCCGGCCCTGTCCACGG + Intergenic
981128465 4:141132867-141132889 CCCCAGCCCCGGCCAACCCCGGG + Intronic
982281112 4:153684405-153684427 CCCCTGCCCGACCCGACCCCAGG - Intergenic
984758405 4:183343977-183343999 CCCCAGCCAGCCCCTGCCCGAGG - Intergenic
984878594 4:184390959-184390981 ACACAGCCCGGCCCTGGCCAAGG - Intronic
984947114 4:184978328-184978350 CCCCAGCTCCGCCCTCCCCGAGG + Intergenic
985444728 4:190015574-190015596 CCCCTGCCCGCCCCTTCCCCCGG - Intergenic
985565097 5:611774-611796 CCCCAGCCAGTCACTCCCCACGG - Intergenic
985573412 5:662666-662688 CCCCAGCGCGGCTCCACCCTGGG - Exonic
985920337 5:2966557-2966579 ATCCAGCCCAGCCCCACCCAGGG + Intergenic
986733418 5:10651316-10651338 CCCATGCCCTGCCCTGCCCAAGG - Intergenic
987099217 5:14577521-14577543 CCCCAACCCTGCCCCACACATGG + Intergenic
987184903 5:15407310-15407332 CCCCAGCCCCGTCCCATCCATGG - Intergenic
989612971 5:43313181-43313203 CCCCCGCCCGGCCCCGCTCACGG + Intronic
997203487 5:132027001-132027023 CCCCACCCCAGCCCTTCCCAAGG + Intergenic
1002108034 5:176889801-176889823 CCCCAGCCCTGCCCATCCCCTGG - Intronic
1002563892 5:180099585-180099607 CCCCAGCCCTGCCTTCTCCACGG + Intergenic
1002891416 6:1335947-1335969 CCCTAGCCCGGCCCGATCAATGG + Intergenic
1003279186 6:4677195-4677217 CCCCAGCAGGGCCTTATCCAGGG + Intergenic
1003993289 6:11510260-11510282 CCCTTGCCCCGCCCCACCCATGG - Intergenic
1006448356 6:34092210-34092232 CCACAGCCCACCCCTCCCCATGG + Intronic
1006460322 6:34154291-34154313 CCCCAGCCCAGCCCAGCCCCTGG + Intronic
1006981939 6:38154245-38154267 GCCCTTCCCGGCCCTCCCCAGGG + Exonic
1007380932 6:41489688-41489710 CCCCAGCCCAGCCCCAGGCAGGG + Intergenic
1007663961 6:43503576-43503598 GCCCAGCCCAGCCCTCTCCAAGG - Intronic
1007665259 6:43509850-43509872 CCCGACCCCGGCCCTATCCCCGG - Exonic
1007697908 6:43745161-43745183 GCCCAGCCCGGCCCAGCCGAAGG + Intergenic
1007704251 6:43781365-43781387 CCCTATTCCGGCCCAACCCATGG + Intronic
1007752168 6:44077145-44077167 CCCCGGCCTGGCCGTGCCCAGGG + Intergenic
1009643091 6:66362722-66362744 CCCCCGCCCCGGCCTGCCCATGG - Intergenic
1010637979 6:78283721-78283743 CCCCATCCTGGCCCTGGCCAAGG + Intergenic
1014811664 6:125893580-125893602 CCACAGCCCCGCCCTCTCCATGG - Intronic
1016175560 6:141074547-141074569 GCCCAGTCCAGCCCTGCCCATGG - Intergenic
1017154471 6:151310497-151310519 CCCCAGCCTCGACCTCCCCAAGG - Intronic
1018003617 6:159600962-159600984 CCTCACCCCAGCCCCACCCATGG + Intergenic
1019138416 6:169927152-169927174 CCTCAGCCCGGCCCCTGCCAGGG - Intergenic
1019404938 7:877989-878011 CTCCAGCCGGGCCCTACACCGGG + Intronic
1019447381 7:1078474-1078496 CCCCAGCCAGGCTCTGCACAAGG + Intronic
1019492371 7:1321427-1321449 CCCCAGGCCGGCTCCCCCCAGGG - Intergenic
1019592746 7:1843922-1843944 CCCCTCCCCGCCCCTAGCCATGG - Intronic
1019711164 7:2518919-2518941 CCCATCCCCGGCCCTTCCCACGG - Intronic
1020080364 7:5283198-5283220 CCCCAGCCCGCCCCTGTCCCGGG + Intronic
1020282096 7:6654872-6654894 TCACAGCCCGGGCCCACCCAGGG - Exonic
1022100332 7:27165475-27165497 GGCCCGCCCGGCCCGACCCACGG + Exonic
1022224475 7:28348811-28348833 CCCCAGCCAGGCCATCCACATGG + Intronic
1022506594 7:30911633-30911655 CCTCAGCCCTGCCCAGCCCAAGG - Intergenic
1022812485 7:33883644-33883666 CCCCATCCCGTCTCTACTCAGGG - Intergenic
1023041920 7:36179966-36179988 ACCCACCCCGGCCCCACTCAGGG - Intronic
1023518490 7:41027330-41027352 CCTCAGCCCTGCCCTGGCCAAGG - Intergenic
1023752720 7:43387210-43387232 CCCCAGCCAGCCCCTTCCCTTGG + Intronic
1023829593 7:44031019-44031041 TCCCAGCCCAGCCCTCACCAGGG - Intergenic
1025198551 7:56948981-56949003 CCCCAGCCCGCCCCTGTCCCGGG - Intergenic
1025673400 7:63627952-63627974 CCCCAGCCCGCCCCTGTCCCGGG + Intergenic
1026736821 7:72954342-72954364 CCCCGCCCCGCCCCTACCCTTGG + Intergenic
1026878863 7:73895254-73895276 TCCCAGCCAGGCCCCATCCATGG - Intergenic
1027106913 7:75410721-75410743 CCCCGCCCCGCCCCTACCCTTGG - Intronic
1027151859 7:75738977-75738999 CGCCCGCCCCGCCCTACCCGCGG + Intergenic
1027215399 7:76180216-76180238 CCCCAACCCCACCCCACCCATGG + Intergenic
1030657536 7:112184419-112184441 CTCCACCCCGGCCTCACCCAGGG + Intronic
1033266835 7:139894263-139894285 CCCCAACCCAGCCACACCCATGG - Intronic
1034901579 7:154911031-154911053 CCCCAGCCCAGAACTCCCCAGGG + Intergenic
1034979583 7:155467376-155467398 CGCCAGGCCTGCCCGACCCAGGG - Intergenic
1035397542 7:158545039-158545061 CTCCAGCCCAGCCCCACCCACGG + Intronic
1035553247 8:545315-545337 CCCTAGCCCTGCCCTATCCCCGG + Intronic
1036417331 8:8562953-8562975 CCCCAGCCCCTCCCAACCCCTGG - Intergenic
1036827133 8:11986314-11986336 CCCCGCCCCGGCCCTGGCCAAGG - Intergenic
1037819953 8:22130733-22130755 CCCCGGCCCGGCCCTCCCCGCGG - Exonic
1037985691 8:23289219-23289241 CCCCAGCCCTGCCCTTCCAAAGG - Intronic
1039531823 8:38269243-38269265 TCCCGGCCCGGCCCTCCCCGCGG - Intronic
1039804192 8:40984755-40984777 CCCCACCCCGACCCCACCCCCGG + Intergenic
1041212745 8:55569300-55569322 TCCCAGCCTGGAACTACCCAAGG + Intergenic
1043585164 8:81760349-81760371 CCCCAGCCCCTGCCTACACAGGG + Intergenic
1045663962 8:104466617-104466639 CCCCCGCCCCGCGGTACCCACGG - Intronic
1046745516 8:117871785-117871807 GCCCACCCCAGCCCTACCCTAGG - Intronic
1049191851 8:141292631-141292653 CCTCAGCCCTGCCCGACCCTCGG + Intronic
1049222961 8:141436202-141436224 CCCCAGCCCTTCCCTTCCCCGGG - Intergenic
1049241148 8:141537960-141537982 GCCCAGCACGGCCCTCACCATGG + Intergenic
1049282489 8:141757157-141757179 CCCAAGCCCTCCCCTCCCCATGG - Intergenic
1049383685 8:142330351-142330373 TCCCAGACCAGCCCAACCCAGGG + Intronic
1049474537 8:142790607-142790629 GCCCGGCCCGGCCCGGCCCATGG - Intergenic
1049581129 8:143411466-143411488 CACCCCCCAGGCCCTACCCAGGG - Intergenic
1049625530 8:143618008-143618030 CCCGAGCCTGGGCGTACCCATGG - Intronic
1049720115 8:144111798-144111820 CCCCAGCCCAGCCCTGACCCTGG + Intronic
1049757929 8:144318987-144319009 TCCCACCCCTGCCCCACCCATGG - Intronic
1049830682 8:144699377-144699399 CCCCACACCGGCCCGCCCCAAGG - Intergenic
1049989543 9:977946-977968 GGCCGGCCCGGCCCTGCCCAGGG + Intronic
1052965725 9:34339222-34339244 ACCCTGCCAGGCCCTCCCCAAGG + Intronic
1053187168 9:36026363-36026385 CCCCTGCCCTGCCTTTCCCAAGG + Intergenic
1053268682 9:36735017-36735039 CGCCAGCCCAGCCCAACCCCAGG + Intergenic
1054449899 9:65398194-65398216 CCCCAGCCCGGCCCTGGCTCCGG - Intergenic
1056221520 9:84454607-84454629 CCCCACTCCTGCCCTACCCCTGG + Intergenic
1057283134 9:93726978-93727000 CCCCAGCTCGGCCCTTCCCTGGG - Intergenic
1059283481 9:113153775-113153797 CCCCTGCCTGCGCCTACCCAGGG - Intronic
1059409683 9:114124248-114124270 CCCCACCCCCACCCTACCCCTGG + Intergenic
1059429616 9:114242027-114242049 CACCTGCCTGGCCCCACCCAGGG - Intronic
1059451951 9:114376334-114376356 CCCCAGCCAGGCTCTATCCCAGG + Intronic
1059677706 9:116555531-116555553 CCCCACCCCGTCCCCACCCCAGG + Intronic
1060105113 9:120868765-120868787 CCCCACCCCGCCCCTCCACAGGG + Intronic
1060198316 9:121637328-121637350 CCCCAGCCCTGCCCACTCCACGG - Intronic
1060484957 9:124041045-124041067 CCCCAGCCCGGACCGAGGCACGG + Intergenic
1060732623 9:126048055-126048077 CCCCAGCCCCACCCTGCACAGGG - Intergenic
1061211997 9:129199023-129199045 CCCCAGCCCGCCCCCTCCCCCGG - Intergenic
1061371645 9:130200852-130200874 CTCCAGCCCTCCCCTCCCCACGG - Intronic
1062064866 9:134521370-134521392 CCCTTGCTCTGCCCTACCCAAGG + Intergenic
1062155567 9:135046295-135046317 CCCCACCCTGCCCCCACCCAGGG - Intergenic
1062209722 9:135357027-135357049 TCCCAGCCCAGCCCTGCCCGGGG + Intergenic
1062243439 9:135551643-135551665 TCCCTGCCCTGCCCTGCCCAAGG - Intergenic
1062283962 9:135764910-135764932 CCCCCGGCCGGCCCTGCCCCAGG + Intronic
1062379487 9:136280401-136280423 CCCCACCCCGGCCCCTCCCCTGG - Intergenic
1062389168 9:136327324-136327346 CCCCAGCCCACCCCACCCCAGGG - Intergenic
1062464884 9:136676543-136676565 CCCCAGCCTGCACCCACCCAGGG + Intronic
1062533518 9:137011779-137011801 CCCCATCCCCGCCCTGCCCCGGG - Intronic
1203792414 EBV:158979-159001 CCCCGGCCAGGCCCTGCCCCCGG - Intergenic
1185476002 X:416039-416061 CCCCACCCCTGCCCACCCCAGGG + Intergenic
1185504336 X:620183-620205 CCCAGGGCTGGCCCTACCCAAGG + Intergenic
1186521778 X:10212660-10212682 CCCCCTCCCTGCCCCACCCATGG - Intronic
1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG + Intronic
1189487101 X:41442422-41442444 CACCACCCCGGCCCCACCCTGGG - Intergenic
1190276615 X:48903296-48903318 CACCACCCCTGCCCCACCCAGGG - Intronic
1192166703 X:68831184-68831206 CCCCAGCCCCGCCCTGCCCCGGG + Intronic
1193442893 X:81565086-81565108 CCACAGCCCTGCCCCACCCCAGG + Intergenic
1196093857 X:111777167-111777189 GGCCAGCCCAGCCCTGCCCATGG - Intronic
1198270902 X:135055383-135055405 CCCCACCCCAGCCCCATCCATGG - Intergenic
1198800134 X:140439718-140439740 CCCCAGCCCGGGCCCGCCCCCGG - Intergenic
1199076351 X:143530599-143530621 CCCCACCCCTTCCCTACCCTAGG - Intergenic
1199851334 X:151726575-151726597 CCTCAGGCCAGCCCTACCCCAGG + Intergenic
1200114683 X:153764940-153764962 CCCCAGCCCAGCCCTGCCCCTGG - Intronic
1200141164 X:153903811-153903833 GCCCAGCCCAGCCCAGCCCAAGG - Intronic
1201065700 Y:10092520-10092542 CCCCTGCCCGCCCCTTCCCCCGG + Intergenic