ID: 1187332581

View in Genome Browser
Species Human (GRCh38)
Location X:18354396-18354418
Sequence TCCGCGGAAGGCGCCGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187332571_1187332581 19 Left 1187332571 X:18354354-18354376 CCGGGGCGGCGTGAGGGGAAACG 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1187332581 X:18354396-18354418 TCCGCGGAAGGCGCCGGGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 159
1187332569_1187332581 21 Left 1187332569 X:18354352-18354374 CCCCGGGGCGGCGTGAGGGGAAA 0: 1
1: 0
2: 1
3: 7
4: 87
Right 1187332581 X:18354396-18354418 TCCGCGGAAGGCGCCGGGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 159
1187332570_1187332581 20 Left 1187332570 X:18354353-18354375 CCCGGGGCGGCGTGAGGGGAAAC 0: 1
1: 0
2: 1
3: 5
4: 135
Right 1187332581 X:18354396-18354418 TCCGCGGAAGGCGCCGGGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187332581 Original CRISPR TCCGCGGAAGGCGCCGGGGG CGG Intronic
900679785 1:3910490-3910512 ACGGCGGCTGGCGCCGGGGGAGG + Intergenic
901440991 1:9278261-9278283 TCCTTGGAAGGCCCCAGGGGTGG + Intergenic
901493893 1:9610550-9610572 GCCACGGAAGGCGCTGGGGAAGG - Exonic
902394461 1:16125082-16125104 TCAGCGGAAGTTGCAGGGGGAGG + Exonic
902773869 1:18661852-18661874 TGGGCGGAGGGCGCCGGGAGGGG + Intronic
903226905 1:21898930-21898952 TCAGCGGGTGGCGGCGGGGGTGG + Intronic
903501020 1:23800284-23800306 TCCGCGCCAGGCGCGGGGCGGGG - Intronic
904782968 1:32964471-32964493 GCCGCGGCAGGGGCCGGGGCGGG + Exonic
905202290 1:36323109-36323131 CCCGCGGAAGGGGTCGGGGTGGG - Intronic
905548525 1:38818243-38818265 TCCGCGGAAGGCGCTGTCGCTGG - Intergenic
905779112 1:40692100-40692122 TTGGCGGAAGGCGACGGCGGGGG + Intronic
906214297 1:44030307-44030329 TCCACCGCAGGGGCCGGGGGCGG - Intronic
907491234 1:54810194-54810216 TCTGTGGAAGGCACCGGGGTGGG - Intronic
915485391 1:156216690-156216712 TCCGCTGCGGGCGCCCGGGGCGG + Intronic
922496756 1:226063096-226063118 TCCGGGGAAGGGGCGGCGGGCGG - Intronic
1064230811 10:13528536-13528558 TGCGGGGAAGGCGGCGGCGGGGG + Intronic
1072294162 10:93993775-93993797 CGCGCGGCAGGAGCCGGGGGCGG + Intergenic
1076857306 10:133123717-133123739 GCCCCAGAAGGTGCCGGGGGGGG - Intronic
1077360724 11:2139205-2139227 CCCGCGGACGGCGCCCGGGACGG + Intronic
1078266435 11:9758859-9758881 TCGGCGGGAGACGCCGGGGAGGG - Intergenic
1079450448 11:20596735-20596757 TCCGCGGAGGGCGGGGGCGGAGG + Intergenic
1080551270 11:33375950-33375972 TGCGCGGGAGCCGCCGGGAGGGG + Intergenic
1081872406 11:46389485-46389507 TCCAGGGAAGGCGCCAGAGGGGG - Intergenic
1083945164 11:65919365-65919387 TCCGCGGGAAACGGCGGGGGCGG + Exonic
1084661475 11:70548976-70548998 TTCCCGGAAGGCCCTGGGGGAGG - Intronic
1085050256 11:73376673-73376695 TGCGCGGAAGGCGCCGGGACAGG - Intronic
1089274859 11:117327960-117327982 ACCCCGGAAGGCTCCGGGCGAGG - Intronic
1090788742 11:130070930-130070952 GCCGCGGGAGGGGGCGGGGGCGG + Intronic
1091973909 12:4810062-4810084 TACGCTGGCGGCGCCGGGGGAGG + Exonic
1096389587 12:51218089-51218111 CCCGCGCCAGCCGCCGGGGGCGG + Intergenic
1096634315 12:52948960-52948982 TGCGCGGAGGGCGCGGGGGTGGG + Exonic
1096826214 12:54280079-54280101 TGCGCAGAAGGCGGCGGCGGTGG - Exonic
1098161055 12:67648680-67648702 GCGGCGGAGGGCGGCGGGGGCGG + Intronic
1103801292 12:123539306-123539328 CCCTCCGAAGGCGCCAGGGGAGG + Intergenic
1104901093 12:132189883-132189905 GCCGGGGGAGGCGCCGGGGAGGG - Intergenic
1105004293 12:132711227-132711249 TGCGCGGAGGGTTCCGGGGGCGG + Intronic
1106517198 13:30465529-30465551 AGCGCGGACGCCGCCGGGGGTGG + Intronic
1112415534 13:99200868-99200890 GCCCCAGAGGGCGCCGGGGGAGG - Exonic
1118676051 14:68185660-68185682 TCCGTGGATGGGGGCGGGGGTGG + Intronic
1119738900 14:77001150-77001172 TCCACGAAAGGCCCCGGGTGCGG + Intergenic
1122736881 14:103848149-103848171 GCCGCGGAAGACGCCGGTGGGGG - Intergenic
1122978752 14:105181685-105181707 TCCGCGGGCGGGGCCGGGGGCGG + Intergenic
1123036897 14:105475228-105475250 TCCTCGGACGGCGCCGGGCGGGG + Intronic
1123053683 14:105559648-105559670 TCCGCGGCAGGCGCTGGGGAGGG + Intergenic
1123078258 14:105680047-105680069 TCCGCGGCAGGCGCTGGGGAGGG + Intergenic
1202899772 14_GL000194v1_random:28352-28374 GCCGGCGCAGGCGCCGGGGGGGG - Intergenic
1125300680 15:38251891-38251913 GCCGCGAAAGGGGGCGGGGGTGG - Intergenic
1126837067 15:52678721-52678743 TCCGCGGCCGGCTCCGGGGGAGG + Intronic
1129159568 15:73739892-73739914 GCCGGGGAGGGGGCCGGGGGCGG - Exonic
1131272266 15:90954705-90954727 TCCGCTGAGGGCGCTGGGGCGGG + Intergenic
1132339404 15:101068587-101068609 TCCTCAGAAGGCACAGGGGGAGG + Intronic
1132579856 16:679913-679935 TCTGCGGATGGGGCTGGGGGCGG + Intronic
1132584679 16:700957-700979 TCCGGAGGAGGCGGCGGGGGCGG + Intronic
1132804896 16:1770904-1770926 CCCGCGGATGGTGCCGGGCGGGG + Exonic
1133292834 16:4734246-4734268 TCCGGGGCGGGTGCCGGGGGCGG - Intronic
1134061720 16:11203194-11203216 TCCGTGGAAGGGGCCAGGGAGGG + Intergenic
1141629080 16:85277079-85277101 TCTGGGGAAGGAGCTGGGGGAGG + Intergenic
1141638621 16:85328814-85328836 ACCGCGGGAGGCCCCGGGGCGGG - Intergenic
1142215258 16:88826667-88826689 TCGGGGGAAGGGGCCGGGGCAGG + Intronic
1142395283 16:89828395-89828417 GGCGCGGAGGGCGCGGGGGGCGG - Intronic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1144854172 17:18258797-18258819 CCCGCGGAATGCGGCGGGCGCGG - Exonic
1145163105 17:20589121-20589143 TCAGCGGCAGGCGCCGGGCCGGG - Intergenic
1145815783 17:27793898-27793920 TCCGCGGCAGACGCCGGCTGCGG - Intronic
1147591850 17:41688984-41689006 CCTGCGGAAGGCGGCGGCGGCGG - Exonic
1147723613 17:42553467-42553489 GCCGCTGGAGGCGCTGGGGGAGG + Exonic
1148852256 17:50560971-50560993 TCCGCGCCAGGCGGCGGGGGAGG - Intergenic
1152687954 17:81703760-81703782 GCCGTGGAAAGCGCCGGGGTCGG + Intronic
1152755108 17:82083944-82083966 GCAGCGGGAGGCACCGGGGGCGG + Intronic
1152812555 17:82388844-82388866 TCCGGGGAGGGCTCCGGGGAGGG - Intergenic
1154012727 18:10589369-10589391 TCCGCGGAAGCCTCCCGCGGCGG - Intergenic
1155300640 18:24426428-24426450 TCCTAGGAATGCGCCGGGGCGGG - Intergenic
1160163707 18:76493319-76493341 TCCGCGGGGGGCGGGGGGGGGGG + Intronic
1160788697 19:913046-913068 GGCGCGGCGGGCGCCGGGGGCGG - Intronic
1161430427 19:4229301-4229323 TGCTCGGAAGGCCCCGAGGGTGG - Intergenic
1161818830 19:6516737-6516759 ACCGCGGAAGACCCCGGAGGCGG - Intergenic
1163154422 19:15432348-15432370 TGGACGGAAGGCGTCGGGGGCGG + Intronic
1163488986 19:17606001-17606023 TGCGCGGAGGGCGCTGGGCGGGG - Exonic
1166000072 19:39872490-39872512 TCCACGGAAGGGGCTGGGGATGG + Exonic
1166872050 19:45876925-45876947 TCCGCGGGAGGAGTCGGTGGTGG + Intergenic
1167042783 19:47032485-47032507 TCCTCGGAAGGGGCAGGGAGTGG - Intronic
1167103792 19:47419216-47419238 GCCGCTGACGGCGGCGGGGGTGG - Exonic
1167103803 19:47419231-47419253 TCAGCGGCAGGCGCCGGGCCGGG + Exonic
1167258089 19:48442982-48443004 GCCGGGGAAGGCGCCGGCGGGGG - Exonic
1167509482 19:49888532-49888554 TCCGTGGAGGGCGGCGGGGTGGG - Exonic
925890071 2:8426220-8426242 TCCGAGCAAGTCCCCGGGGGGGG + Intergenic
926101757 2:10122528-10122550 TCTCCGGAAGGCGCCGGCGGAGG + Exonic
934067140 2:88350731-88350753 GCCCGGGAAGGCGGCGGGGGAGG - Intergenic
937043135 2:118836164-118836186 TCCGCGGACCGTGCCGGGCGCGG + Intergenic
937119447 2:119431719-119431741 GCCGCGGAGGGCGGCGGGGTTGG + Intronic
937338674 2:121077189-121077211 GCCGCGGAAGGGGCCGGGATGGG + Intergenic
942685161 2:178523196-178523218 TCCTCTGAAGACGCGGGGGGAGG - Intergenic
946692397 2:222319458-222319480 TCCTCGGCAGGCGGCGGCGGCGG + Intergenic
948059393 2:235032151-235032173 TCCGAGGACTGCGCCGGGTGAGG - Intronic
1168883400 20:1226019-1226041 TGCGCGGCAGGCGCGGGGCGGGG - Intergenic
1168953227 20:1816924-1816946 TCCCAGGAAGGCCTCGGGGGAGG - Intergenic
1175215916 20:57391637-57391659 GCCGTGCATGGCGCCGGGGGCGG - Exonic
1175234264 20:57499059-57499081 TCCCCTGAAGGTGACGGGGGGGG + Intronic
1175251495 20:57612777-57612799 TCCGCGGAATGCTACAGGGGAGG - Intronic
1175839782 20:62019659-62019681 TCCCTGGAAGGCTCTGGGGGAGG - Intronic
1176029533 20:63005283-63005305 GCAGCGGATGGCGGCGGGGGGGG + Intergenic
1176546938 21:8206238-8206260 TCCGCTGCGGGCGCCCGGGGCGG + Intergenic
1176554843 21:8250447-8250469 TCCGCTGCGGGCGCCCGGGGCGG + Intergenic
1176565889 21:8389285-8389307 TCCGCTGCGGGCGCCCGGGGCGG + Intergenic
1176573764 21:8433472-8433494 TCCGCTGCGGGCGCCCGGGGCGG + Intergenic
1179529542 21:42009633-42009655 TCCGCGGGAGGGGCCGGGGGCGG + Intronic
1179608086 21:42531210-42531232 TGCGGGGAAGGCGGCGGGGCCGG - Intronic
1179888739 21:44325525-44325547 TCGGCGGAAGTGGCCGCGGGAGG - Intronic
1180110263 21:45644030-45644052 GCCGCCGCAGGCGCCGGCGGCGG - Intronic
1180177647 21:46098235-46098257 TCCTGGGAAGGCGGCGGCGGCGG + Intronic
1180685634 22:17664417-17664439 TCTGTGAAAGGAGCCGGGGGGGG - Intronic
1180699706 22:17774534-17774556 TCCCCGCAAGCCGCCGGGGGCGG - Intronic
1184636130 22:45833266-45833288 GCTGCTGAAGGCGTCGGGGGAGG + Intronic
1185259590 22:49854038-49854060 CCCGCGGACCGCGCCGGGGCCGG + Intronic
1185388925 22:50548628-50548650 TCAAGGGGAGGCGCCGGGGGAGG + Exonic
1203251813 22_KI270733v1_random:122523-122545 TCCGCTGCGGGCGCCCGGGGCGG + Intergenic
1203259864 22_KI270733v1_random:167606-167628 TCCGCTGCGGGCGCCCGGGGCGG + Intergenic
949105418 3:196893-196915 TCCGCGGACAGCCCCGGGTGCGG + Exonic
953834203 3:46329053-46329075 TCAACTGAAGGAGCCGGGGGAGG + Intergenic
953981945 3:47417684-47417706 GCGGCGGAGGGCCCCGGGGGCGG + Exonic
954402876 3:50328194-50328216 CCTGCGGAAGGCGGCGGCGGCGG - Exonic
956749861 3:72336914-72336936 TCCAGGGAAGCCGGCGGGGGGGG + Intergenic
962808780 3:138945249-138945271 ACCGCGGAAAGGGCCCGGGGCGG - Exonic
970456225 4:16226561-16226583 GCCGCGGATGGCGGCGGCGGCGG - Intronic
980929992 4:139176464-139176486 TCTGCGGCCGGCGCCGGGGCTGG - Intronic
981726045 4:147848349-147848371 TCCAAGGAAGGAGCCTGGGGTGG - Intronic
985754676 5:1706259-1706281 TCCAGGGAAGGCGCCCGCGGAGG - Intergenic
999295885 5:150459130-150459152 TGGGCGGAAGGCGCAGGGTGAGG + Intergenic
1001422172 5:171596397-171596419 TCCCTGGATGGGGCCGGGGGTGG - Intergenic
1006108630 6:31730953-31730975 TCCCCGGAAGGCCTCGGGGATGG + Exonic
1006682196 6:35805325-35805347 TCCGCGGACGGAGGAGGGGGCGG + Exonic
1007406478 6:41638700-41638722 TCAGCGGGCGGCGCCGGAGGCGG - Intronic
1007548396 6:42710622-42710644 TGCGCGGAAGGGGCCGGGGGCGG + Intronic
1007673482 6:43575957-43575979 GCCGCGGCGGGCGGCGGGGGTGG + Exonic
1012475910 6:99614289-99614311 GCGGCGGGAGGCACCGGGGGCGG + Exonic
1013033807 6:106361053-106361075 TCTCCGGCAGGCGCCGGGAGCGG - Intergenic
1013547583 6:111173892-111173914 TCCATGGATGGTGCCGGGGGAGG - Intronic
1016447775 6:144150571-144150593 GCCGCAGGAGGCGCCGGGAGCGG + Exonic
1018613397 6:165663270-165663292 GGCGCGGAAGGCGGCGGCGGCGG - Intronic
1019328344 7:450721-450743 TCTGCGGGAGGGGCTGGGGGTGG - Intergenic
1019343717 7:519916-519938 TCCGGGGGAGGCGGGGGGGGGGG - Intronic
1019474346 7:1236744-1236766 TCCCGGAAAGGCGCCGGGGCCGG - Exonic
1019807065 7:3135609-3135631 TCCGCAGAAGGGGCCGGGCAGGG - Intergenic
1026017532 7:66682652-66682674 TCCCCGGAACGCGCCGGGATGGG + Intronic
1029390690 7:100272061-100272083 TCGGCGCCAGGCGCGGGGGGCGG + Exonic
1029490075 7:100866179-100866201 GCCTCGGGAGGCGCCTGGGGCGG + Exonic
1032123376 7:129172987-129173009 TCCCCGGAAGCCTCCAGGGGAGG + Intergenic
1033253110 7:139777556-139777578 GCCGCGGAGGGCGGCGGGCGCGG + Intronic
1033253175 7:139777773-139777795 CCCGTGGCCGGCGCCGGGGGAGG + Intronic
1033644303 7:143288696-143288718 TCCGCGCAAGGGCCCGCGGGCGG + Intronic
1035714982 8:1747075-1747097 TCCCCTGAAGGCTCCAGGGGAGG - Intergenic
1036454301 8:8893707-8893729 GCTGCGGAGGGCGCCGGGTGCGG + Intergenic
1039454795 8:37699352-37699374 TGCGCGGAGGGTGGCGGGGGAGG - Exonic
1039608422 8:38901177-38901199 TCCGCGGAGCCCGCCGGGGAGGG - Intergenic
1039921206 8:41895903-41895925 TCCGGGGAGCGGGCCGGGGGGGG - Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1043502822 8:80873887-80873909 TCCGGGGCGGGCGCCGGGGCCGG + Intronic
1047469926 8:125160445-125160467 TCCTCGGAAGGGGTTGGGGGTGG + Intronic
1048254268 8:132893857-132893879 TCCGCGAAAGCCTCCCGGGGCGG - Exonic
1048472150 8:134713097-134713119 GCCGCGCTCGGCGCCGGGGGAGG - Intergenic
1054760327 9:68999023-68999045 TCCTCTGAAGGCTCCAGGGGAGG + Intronic
1057080452 9:92171091-92171113 GCTGGGGGAGGCGCCGGGGGCGG - Intergenic
1057314604 9:93960387-93960409 TCTGCGGGAGCCGCCGGGGCTGG - Intergenic
1059102637 9:111484422-111484444 TCGGCGGGAGGCGCAGGGCGGGG - Exonic
1059453468 9:114385472-114385494 GCTGAGGAAGGGGCCGGGGGAGG + Intronic
1060796982 9:126519196-126519218 TCCGCGGTGGCTGCCGGGGGAGG - Intergenic
1061737356 9:132670503-132670525 GCCGCGGAGGGCGCTGGGGGTGG + Exonic
1062543982 9:137053687-137053709 TACGCGGAGGGGGCGGGGGGCGG - Intronic
1062655991 9:137604961-137604983 TGCGGGGCAGGAGCCGGGGGTGG + Intergenic
1203468215 Un_GL000220v1:105674-105696 TCCGCTGCGGGCGCCCGGGGCGG + Intergenic
1203476036 Un_GL000220v1:149646-149668 TCCGCTGCGGGCGCCCGGGGCGG + Intergenic
1187332581 X:18354396-18354418 TCCGCGGAAGGCGCCGGGGGCGG + Intronic
1189325768 X:40109714-40109736 TCCCCGGAGGGCGTGGGGGGCGG + Intronic
1190305637 X:49080018-49080040 TCCGGGGAGGGCGCGGGGAGCGG + Intronic
1200218590 X:154379636-154379658 GCCGGGGAAGGCGCGCGGGGAGG - Intronic