ID: 1187333086

View in Genome Browser
Species Human (GRCh38)
Location X:18358382-18358404
Sequence TAACTAAGCCTGGCAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187333082_1187333086 -5 Left 1187333082 X:18358364-18358386 CCCTAAAACACAGAAGCCTAACT No data
Right 1187333086 X:18358382-18358404 TAACTAAGCCTGGCAGAGACTGG No data
1187333078_1187333086 28 Left 1187333078 X:18358331-18358353 CCTCTAGTTTTCCTACTAAATGG No data
Right 1187333086 X:18358382-18358404 TAACTAAGCCTGGCAGAGACTGG No data
1187333081_1187333086 17 Left 1187333081 X:18358342-18358364 CCTACTAAATGGGCATCTTTCTC No data
Right 1187333086 X:18358382-18358404 TAACTAAGCCTGGCAGAGACTGG No data
1187333077_1187333086 29 Left 1187333077 X:18358330-18358352 CCCTCTAGTTTTCCTACTAAATG No data
Right 1187333086 X:18358382-18358404 TAACTAAGCCTGGCAGAGACTGG No data
1187333083_1187333086 -6 Left 1187333083 X:18358365-18358387 CCTAAAACACAGAAGCCTAACTA No data
Right 1187333086 X:18358382-18358404 TAACTAAGCCTGGCAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187333086 Original CRISPR TAACTAAGCCTGGCAGAGAC TGG Intergenic
No off target data available for this crispr