ID: 1187341609

View in Genome Browser
Species Human (GRCh38)
Location X:18425909-18425931
Sequence AGGGCTTCCCCCGAGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 179}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187341592_1187341609 18 Left 1187341592 X:18425868-18425890 CCCGGAGTAGCCCCTCCTCAGCG 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1187341603_1187341609 -9 Left 1187341603 X:18425895-18425917 CCTGCGCCTCTGGAAGGGCTTCC 0: 1
1: 0
2: 2
3: 20
4: 206
Right 1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1187341601_1187341609 -7 Left 1187341601 X:18425893-18425915 CCCCTGCGCCTCTGGAAGGGCTT 0: 1
1: 0
2: 0
3: 20
4: 145
Right 1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1187341590_1187341609 23 Left 1187341590 X:18425863-18425885 CCCAGCCCGGAGTAGCCCCTCCT 0: 1
1: 0
2: 0
3: 13
4: 188
Right 1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1187341591_1187341609 22 Left 1187341591 X:18425864-18425886 CCAGCCCGGAGTAGCCCCTCCTC 0: 1
1: 0
2: 1
3: 19
4: 200
Right 1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1187341602_1187341609 -8 Left 1187341602 X:18425894-18425916 CCCTGCGCCTCTGGAAGGGCTTC 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1187341597_1187341609 3 Left 1187341597 X:18425883-18425905 CCTCAGCGCTCCCCTGCGCCTCT 0: 1
1: 0
2: 0
3: 30
4: 381
Right 1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1187341596_1187341609 6 Left 1187341596 X:18425880-18425902 CCTCCTCAGCGCTCCCCTGCGCC 0: 1
1: 0
2: 5
3: 49
4: 401
Right 1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1187341595_1187341609 7 Left 1187341595 X:18425879-18425901 CCCTCCTCAGCGCTCCCCTGCGC 0: 1
1: 0
2: 2
3: 33
4: 333
Right 1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1187341594_1187341609 8 Left 1187341594 X:18425878-18425900 CCCCTCCTCAGCGCTCCCCTGCG 0: 1
1: 0
2: 3
3: 31
4: 367
Right 1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1187341593_1187341609 17 Left 1187341593 X:18425869-18425891 CCGGAGTAGCCCCTCCTCAGCGC 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187341609 Original CRISPR AGGGCTTCCCCCGAGGGGCT GGG Intronic
900346930 1:2214561-2214583 AGAGCTTCTCCCGGGGGTCTTGG - Intergenic
900427807 1:2588411-2588433 CGGGCTTCCCCAGAGCTGCTGGG - Exonic
901972360 1:12918122-12918144 AGTCCTTTCCCAGAGGGGCTGGG - Intronic
902012819 1:13283640-13283662 AGTCCTTTCCCAGAGGGGCTGGG + Intronic
902034858 1:13450225-13450247 AGGGGTCACCCCGAGGGTCTAGG + Intergenic
902982733 1:20137632-20137654 AGGGCTTCCCCCTTGGGACAAGG - Intergenic
904015676 1:27418553-27418575 GGGGCTTCCCCAGAGGGGGAGGG - Intronic
904706439 1:32394479-32394501 AGGACCGCCCCCGAGGCGCTCGG + Intronic
906960252 1:50415742-50415764 TGGGCTTCCACCGCGGGGCCTGG + Intergenic
913565754 1:120070317-120070339 AAGGCTTTCCCAGAGGAGCTGGG + Intergenic
913632375 1:120723237-120723259 AAGGCTTTCCCAGAGGAGCTGGG - Intergenic
914286346 1:146229691-146229713 AAGGCTTTCCCAGAGGAGCTGGG + Intergenic
914547378 1:148680433-148680455 AAGGCTTTCCCAGAGGAGCTGGG + Intergenic
914619137 1:149389927-149389949 AAGGCTTTCCCAGAGGAGCTGGG - Intergenic
916244241 1:162671143-162671165 AGGGCTGCCCCTGAGGAGCTGGG + Intronic
919658602 1:200221633-200221655 AGGGCTTCATCTGAGGGGCAAGG - Intergenic
919744588 1:201000485-201000507 AGGGCTGCCCCCGAAGGCCGGGG + Exonic
920258402 1:204672365-204672387 AGGGCTCCCCAAGTGGGGCTAGG + Intronic
1063477854 10:6344338-6344360 AGGGCTGCCTCTGAGGAGCTAGG + Intergenic
1063604098 10:7507928-7507950 ACGGCTTCCTCAGAGGGGGTGGG + Intergenic
1067064151 10:43094212-43094234 AGGGCTCCTCCCTGGGGGCTGGG - Intronic
1067937187 10:50623028-50623050 AGGGCTGCCCCCGCGGGGCGGGG - Intronic
1073152950 10:101324057-101324079 AAGGCTTCCCCTGAGGTGCAAGG - Intergenic
1073178317 10:101569718-101569740 AGAGCTTCCCCGGGGGAGCTGGG + Intergenic
1074863544 10:117531804-117531826 GGGTCTTCCCCAGATGGGCTTGG - Intergenic
1076336520 10:129710238-129710260 AGGGCTTTCCAAGAGGGGCAGGG - Intronic
1077080685 11:723301-723323 AGGGCATCCCCCGGGGGGGTGGG - Exonic
1077144995 11:1040750-1040772 AGGGCCTCCTCTGAGGTGCTAGG - Intergenic
1078005997 11:7532674-7532696 GAGGCTTCCCCCGAAGGCCTGGG - Intronic
1078318180 11:10308739-10308761 AGGGTCCCCTCCGAGGGGCTAGG + Intronic
1084124261 11:67088596-67088618 AGGGCTTCCCCAGGTTGGCTAGG + Intergenic
1084165235 11:67372438-67372460 AAGGTTTCCTTCGAGGGGCTCGG + Intronic
1084312519 11:68325178-68325200 AGGGCCTCTCCCGGAGGGCTGGG + Intronic
1085277936 11:75311964-75311986 AGGGCCTGGGCCGAGGGGCTGGG + Intronic
1085304296 11:75476523-75476545 AGGGCTTCCCAGCAGGGGCCTGG + Intronic
1085870523 11:80344274-80344296 AGGGCTTCTCCCAATGGCCTTGG + Intergenic
1090013229 11:123062822-123062844 AGGGCTGACCCCGAGGGGCTGGG + Intronic
1091786035 12:3243955-3243977 AGGGCTTACCCGCAGGGTCTTGG + Intronic
1091907188 12:4198522-4198544 GGGGCTTCCCCCGAGGAACATGG + Intergenic
1095481078 12:42636502-42636524 AGGGCTGCTTCTGAGGGGCTTGG + Intergenic
1096777950 12:53975062-53975084 AGGGCTGCCCGCGGTGGGCTAGG + Intronic
1099481866 12:83177269-83177291 AGGGATTCTCCCGAGTAGCTGGG - Intergenic
1101813844 12:108130215-108130237 AGGGCTTCTCCCGCGGAGGTGGG + Intronic
1107722880 13:43267395-43267417 TGGCCTTCCCTGGAGGGGCTGGG + Intronic
1107802907 13:44126979-44127001 AGCGCTTCGCCCAGGGGGCTGGG - Intergenic
1112170607 13:96968475-96968497 AAGGCTTCCCCCAACGGGCTAGG - Intergenic
1113662694 13:112118016-112118038 AGGGCTTCCACCGCGGCACTTGG - Intergenic
1121018153 14:90561212-90561234 ACTGGCTCCCCCGAGGGGCTGGG + Intronic
1121915264 14:97832535-97832557 GGGGCTTCTCCCGAGTGCCTGGG + Intergenic
1122408617 14:101514675-101514697 GGGGCTGCCCCTGAGGGGCCTGG - Intergenic
1122411636 14:101528787-101528809 TGGGCCTCCCCAGAGGGGCCGGG + Intergenic
1122470345 14:101961966-101961988 AGGGGTTCCTCTGAGGGGGTTGG + Intergenic
1122747974 14:103910953-103910975 AGGGCTTCCCCACAAAGGCTGGG - Intergenic
1122767455 14:104082015-104082037 AGGGCTCCCCACCAGGGGCTGGG - Intergenic
1124215930 15:27807096-27807118 AGGGCTTCCCCAGAGGTGGGCGG - Intronic
1126106337 15:45149264-45149286 AGGGCTTCCCCCTGGGGGTAAGG + Intronic
1130124985 15:81085659-81085681 AGGGCTCCTCCCCAGGGCCTTGG - Intronic
1131157227 15:90082577-90082599 TGAGCTTCCTCCCAGGGGCTGGG + Intergenic
1133279898 16:4659388-4659410 TGGGGCTCCCCAGAGGGGCTGGG - Intronic
1134041876 16:11075306-11075328 AGGGCTTCCAGGGAGGGGCAGGG + Intronic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1138423556 16:56915462-56915484 AGGGCTTGCTACGAGGGACTGGG + Exonic
1138505600 16:57476813-57476835 AGGGACTCCCCCAAGGGGGTGGG + Intronic
1138602317 16:58063394-58063416 GGGGCTTCCTCCATGGGGCTGGG + Intergenic
1139361781 16:66403955-66403977 AGGCCTTCTCCAGAGGGGGTGGG - Exonic
1140260252 16:73371875-73371897 ACTGCTTGCCCAGAGGGGCTGGG - Intergenic
1141253869 16:82383003-82383025 AAGGCAACCCCCGAGGGGGTTGG + Intergenic
1141695504 16:85617246-85617268 AGAGCTGCCCCCGGGAGGCTGGG + Intronic
1142189569 16:88711724-88711746 AGGGCTTACCCCAAGTGGCCAGG - Intronic
1142287813 16:89178561-89178583 AGGGCTGCCTCGGTGGGGCTGGG - Intronic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1143697316 17:8630316-8630338 AGGGCGACCCCTGGGGGGCTGGG - Intronic
1144674241 17:17151844-17151866 AGAGCTGCCCCCATGGGGCTGGG + Intronic
1145752385 17:27364466-27364488 AGGCCTTCTCCCGGAGGGCTTGG + Intergenic
1146951684 17:36910911-36910933 AGGGCTTTCCTGGAGGGGTTTGG - Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1148471478 17:47896382-47896404 GGGGGTTCCCCCCTGGGGCTGGG + Intronic
1148741687 17:49896919-49896941 TGGACTTCCCCCGCAGGGCTTGG + Intergenic
1151361724 17:73593134-73593156 AGGTCTTCCCTCGACAGGCTGGG + Intronic
1151912789 17:77095034-77095056 CCGGCTTCCCCACAGGGGCTGGG + Intronic
1153274946 18:3359331-3359353 AGGATTTCCACCGAGGGGCACGG + Intergenic
1153313976 18:3704125-3704147 AGAGCATCCTCCTAGGGGCTAGG - Intronic
1154161018 18:11981179-11981201 AGGGCTAGCCCAGAGGGGCGGGG + Intronic
1157260948 18:46174759-46174781 ACTGCTTCCCCCGCGGGCCTAGG - Intronic
1158625067 18:59063709-59063731 AGGTCTTCCTCCCAGGGGCGTGG - Intergenic
1160789168 19:915210-915232 AGGGCTTCCCTTCAGGGGCCTGG + Intergenic
1161399064 19:4059591-4059613 AGGGCTGACTCCCAGGGGCTGGG + Intronic
1161620684 19:5295428-5295450 ACAGCCACCCCCGAGGGGCTGGG + Intronic
1161741347 19:6022815-6022837 AGGCCTCCCCTCTAGGGGCTTGG - Intronic
1161925262 19:7294531-7294553 AGGGCCTCCCGCGCGGGGCCCGG - Intergenic
1162478323 19:10914078-10914100 AGGGCCTCCACCGAGGGGCCTGG - Intronic
1164835004 19:31350525-31350547 GGGGCTCCCCCCGAGAGCCTAGG + Intergenic
1164840442 19:31388981-31389003 AGGGCAGCCCCCCAGGGTCTCGG - Intergenic
1165388112 19:35523601-35523623 TGTGCTTCTCCCGAGGGGCGGGG - Intronic
1165413943 19:35679688-35679710 AGGCCTTCCCAAGAGGGCCTGGG + Intergenic
1165827110 19:38711743-38711765 AGTGCTCCCCACGAAGGGCTTGG - Intronic
1165928713 19:39342734-39342756 GGGGCTTCTCCCGTGGGGCCCGG - Intronic
1166368378 19:42288662-42288684 AGGGCTGCCCCCCAGGGAATGGG + Intronic
1168404902 19:56105601-56105623 GAGGCTTCCCCCGAGAAGCTGGG - Intronic
925067750 2:941881-941903 AGTGCTTCCCTCCAGGGCCTTGG - Intergenic
926224035 2:10954861-10954883 AGGGCTTCCCCAATGGGGTTAGG + Intergenic
927091758 2:19717817-19717839 AAGCCTTCCCCCAAGGGGCTGGG + Intergenic
932423640 2:71615518-71615540 GGGGCTTCCCCAGAGGGCCAGGG - Intronic
934819543 2:97360289-97360311 AGGGCTCCTCCCCAGGGGCTGGG - Intergenic
936093353 2:109514813-109514835 AGGGCTGCCCCCCAGGCCCTGGG + Intergenic
936093670 2:109516268-109516290 AGGGCTGCCCCCCAGGCCCTGGG - Intergenic
936593143 2:113822611-113822633 GGGGATTCCCCAGAGGGACTTGG - Intergenic
936954818 2:118013581-118013603 AGGGCTAGCCCCGAGGGCCGAGG - Intronic
938198949 2:129357294-129357316 TGGGCTTCCAAAGAGGGGCTGGG - Intergenic
946332513 2:219018384-219018406 AGAGCTGCCCCCGAGGGTCCTGG - Intronic
946371373 2:219283509-219283531 GGGGCTTCCTGCCAGGGGCTGGG - Intronic
947716495 2:232341850-232341872 AGGGCTTCTCCAGAGCTGCTTGG - Intronic
947835199 2:233170168-233170190 AGGGCTGCCCGCCTGGGGCTGGG + Intronic
948134995 2:235629760-235629782 AGGGATCCTCCAGAGGGGCTGGG - Intronic
948920935 2:241065631-241065653 AGCGCTGCCCTCGAGGGGCAGGG - Intronic
1169195824 20:3681618-3681640 TGGGCTGCCCCCGAGGGGGAGGG + Intronic
1170763773 20:19273562-19273584 AGGGCTGCCCCTCAGGGTCTGGG + Intronic
1171244855 20:23602956-23602978 TGGGGTTCCCCTGAGGGGCACGG - Exonic
1171252071 20:23656161-23656183 AGGCCTCCCCGGGAGGGGCTGGG + Intergenic
1172957133 20:38768988-38769010 AGGACTTCCTCCTAGAGGCTGGG - Intronic
1173540066 20:43844386-43844408 AGGGCTGGCCCCCAGGGCCTTGG + Intergenic
1176064401 20:63187260-63187282 AGGACCAGCCCCGAGGGGCTTGG + Intergenic
1176084513 20:63289920-63289942 AGGGCCTCCCCAGGAGGGCTAGG - Intergenic
1178985421 21:37298828-37298850 AAGGCTTCCCCCAAGGGTCTGGG - Intergenic
1180193535 21:46180824-46180846 AGGCCTTCCACAGAGGGCCTTGG - Intronic
1181020649 22:20100424-20100446 AGCACTTCCCCAGAGGGCCTTGG - Intronic
1182618938 22:31607738-31607760 TGGGCTTCCTGTGAGGGGCTGGG + Intronic
1184405890 22:44300602-44300624 AGGGCTTCTCCCGAGGGTCCTGG + Intronic
1185107559 22:48882940-48882962 AGGGCTGCCCCCGGTGGGCTGGG - Intergenic
1185344614 22:50305855-50305877 TGGTCTCCCCCAGAGGGGCTTGG + Intronic
949987776 3:9553555-9553577 GGGGCTGTCCCCGGGGGGCTGGG + Intronic
952759704 3:36903256-36903278 CAGGGTTCCCCCGAGGGACTTGG - Exonic
952960748 3:38587724-38587746 AGAGCTGTCCCCAAGGGGCTGGG - Intronic
954396585 3:50296493-50296515 AAAGCTGCCCCCCAGGGGCTAGG + Exonic
956784810 3:72633667-72633689 AGGGCTCCCCACCAGGAGCTAGG + Intergenic
967390313 3:188948358-188948380 GGGGCTGGCCCGGAGGGGCTGGG - Intronic
968574701 4:1360167-1360189 AGGGCTGCCCACGGGGGGCGGGG + Intronic
968800896 4:2742755-2742777 AGGACTTCCACCAAGGGGCTGGG - Intronic
969436535 4:7192416-7192438 CGGGCTTCCCACGAGCGCCTGGG + Intergenic
970511800 4:16788569-16788591 AGGGCATCCCCATAGGGGTTGGG - Intronic
976163794 4:82231749-82231771 AGGGCTGCCCCCAAGGTCCTAGG - Intergenic
976871320 4:89797082-89797104 ATGGCTACCCCCATGGGGCTGGG - Intronic
980130029 4:128809846-128809868 AGGGGTTCGGCCGAGGCGCTGGG - Exonic
985854780 5:2416417-2416439 AGAGCTTCCCGGGAGGGGCCGGG + Intergenic
988536314 5:32072324-32072346 AGGGGTGCCCCAGAGGGCCTGGG + Intronic
989118212 5:37977404-37977426 AGGGCTGCCTCAGAGGGTCTTGG + Intergenic
992484202 5:77180142-77180164 TGGACTTCCCTCGAGGGGCCAGG + Intergenic
994097841 5:95863145-95863167 AGGGCTTTCCATGAGGGGCGTGG + Intergenic
995347258 5:111135114-111135136 AGGGCCACCCCCCAGGGGCCTGG + Intergenic
1001299254 5:170522203-170522225 AGGGCTTCCCTGGATAGGCTTGG - Intronic
1002303441 5:178270276-178270298 GGGGCTGCCACCGTGGGGCTAGG - Intronic
1004015391 6:11727593-11727615 AGGACATCCCCCCAGAGGCTTGG + Intronic
1005898651 6:30198657-30198679 AGGGCTTACCCTGTGGGGCTGGG + Exonic
1005992734 6:30913714-30913736 AGGGCTGCCACCAAGGAGCTGGG + Intronic
1006385618 6:33729220-33729242 AGGCCTTCCTCCGTGGAGCTTGG + Intronic
1007966070 6:46004795-46004817 AGGGCTTCCCCACAGGCTCTGGG - Intronic
1008513262 6:52297016-52297038 AGCGATTCCCCCGAGTAGCTGGG + Intergenic
1012982202 6:105842742-105842764 AGGGTTTCCCCCGATGAGATGGG + Intergenic
1014246922 6:119078885-119078907 AGTGCTTCCCCCGTGTGGCGGGG + Intronic
1017731823 6:157323674-157323696 AGGGCATCGCCCCTGGGGCTGGG - Intergenic
1019057768 6:169235514-169235536 AGGGCTTCCCCAGGGAGGCCTGG - Intronic
1020045575 7:5037761-5037783 AGGGGGTACCCCGAGGCGCTGGG + Intronic
1023352749 7:39336489-39336511 CAGGCTTGCACCGAGGGGCTGGG + Intronic
1024608796 7:51045633-51045655 AGGGCCTCCTCCAAGGGGCCTGG - Intronic
1026896690 7:74013598-74013620 AGACCCTCCCCCCAGGGGCTGGG + Intergenic
1029566851 7:101344440-101344462 AGCGATTCTCCCGAGTGGCTGGG + Intergenic
1029600882 7:101562834-101562856 AAGGTCTCCCCCAAGGGGCTGGG + Intergenic
1031974367 7:128084570-128084592 AGGGCTTCCCCGCATGGGTTGGG + Intronic
1033278359 7:139989180-139989202 AGGGCAACCCCTGAGGGTCTTGG - Intronic
1033610686 7:142961149-142961171 AAGGGCTCCCCCAAGGGGCTAGG + Intronic
1034204657 7:149304918-149304940 AAGGCGTCCCTCCAGGGGCTTGG + Intergenic
1034343156 7:150370551-150370573 AGTGCCTCCCCTGTGGGGCTAGG + Intronic
1035253592 7:157612824-157612846 AGGGCATCCACAGAGGCGCTGGG + Intronic
1035359291 7:158299797-158299819 AGGGCTTCCCTGGGGGGCCTGGG - Intronic
1036282623 8:7414734-7414756 AGGGCTGCCACAGCGGGGCTTGG - Intergenic
1036338850 8:7896815-7896837 AGGGCTGCCACAGCGGGGCTTGG + Intergenic
1038612420 8:29068905-29068927 AGTGCCTCCCCCCAGGGGCCGGG + Exonic
1040980900 8:53245383-53245405 AGGGCTTCCCCTGAGGCCCGAGG - Intronic
1044964907 8:97565380-97565402 AGGGCTTTCCACGAGAGGCTTGG - Intergenic
1049210370 8:141383750-141383772 AGGAGTTCCCCAGAGAGGCTCGG + Intergenic
1049282569 8:141757884-141757906 AGAGCTTTCCCCTCGGGGCTGGG - Intergenic
1049347111 8:142144944-142144966 AGGGCTTCCTGGGATGGGCTGGG - Intergenic
1053271695 9:36754395-36754417 TGGGCTTACCCCGAGGGCATTGG + Intergenic
1059418216 9:114175126-114175148 GGGGCTTCCCCCAAGGGTCCTGG - Intronic
1061178063 9:129009216-129009238 AGGCCTCCCCCGGAGGGGCCAGG + Exonic
1061325075 9:129858828-129858850 AGGGCCTCCCTTGAGGAGCTCGG + Intronic
1061920297 9:133778830-133778852 CAGGCTTCCCGGGAGGGGCTGGG + Exonic
1062523420 9:136968961-136968983 GGGGCTTCCCCAGAGGACCTTGG - Intergenic
1185595215 X:1302204-1302226 AGAGCTTCCCCGGACGGGCAGGG - Intronic
1186410997 X:9344225-9344247 AGGGCTCCTCCCGAGGCTCTGGG - Intergenic
1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG + Intronic
1189664646 X:43340903-43340925 AGAGGTTCCCCCAAGGGGGTGGG + Intergenic
1192314685 X:70042600-70042622 AGGGGTTCCCAGGAGGGTCTGGG - Intronic
1197269917 X:124414227-124414249 AGGGCTTCCCACAAAGGGCAAGG + Intronic
1199770688 X:150973457-150973479 GGGGCTTCCCCTGAGGAGGTGGG + Intergenic
1199851850 X:151729445-151729467 AGGGCTTTGCCCAAGAGGCTTGG - Intergenic