ID: 1187344798

View in Genome Browser
Species Human (GRCh38)
Location X:18453152-18453174
Sequence TTGTGTGACCAAAAAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187344798 Original CRISPR TTGTGTGACCAAAAAGAAGA GGG (reversed) Intronic
904595258 1:31640383-31640405 TTGAGTGAACAAACAGAAGGGGG - Intronic
904821410 1:33247062-33247084 TTGTGTGTGAAAAAAGCAGAGGG - Intergenic
905300449 1:36983027-36983049 ATGTGTGTGCAATAAGAAGAGGG - Intronic
905978838 1:42204265-42204287 TTGATTGAAAAAAAAGAAGAGGG - Intronic
905993792 1:42363436-42363458 CTGTGTGTCCAAAAAGAAAGTGG - Intergenic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
907035200 1:51210375-51210397 TTCTGTGACCAAAAAGGTGTGGG + Intergenic
907902920 1:58757622-58757644 TTCTGTGAAAAAAAATAAGATGG - Intergenic
908481838 1:64548159-64548181 TTGTTTTAACAAAAAGGAGAAGG + Intronic
909379193 1:74977987-74978009 TTGTGAGGCCAAAATTAAGAGGG + Intergenic
909982907 1:82125698-82125720 TTACTTGACAAAAAAGAAGAGGG - Intergenic
911613124 1:99978673-99978695 TTTTGTGAGCAAAAAGTGGATGG + Intronic
911802781 1:102164583-102164605 TTGAGTGACAAAAAAGACAAAGG + Intergenic
912156534 1:106928011-106928033 TTTTGTGACCAAAATGCAAAAGG + Intergenic
915193861 1:154174540-154174562 TTTTGAGACCAAAAAAAAGAGGG + Intronic
917563084 1:176180136-176180158 TTTAATGACCAAATAGAAGAAGG - Intronic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918860307 1:189816627-189816649 TTATTCAACCAAAAAGAAGAGGG + Intergenic
919868835 1:201804833-201804855 TTATGGAACCAAAAAGAAGAAGG - Intronic
920078962 1:203358319-203358341 TTGTGAGACAAAACAGAAGTAGG + Intergenic
921956720 1:220992696-220992718 TAGTTTGTCCAAAAAGAAGAAGG - Intergenic
922070045 1:222183388-222183410 TTGTGTAACACAAAAGAACAAGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063402366 10:5758591-5758613 TTGTGTGACAGAAGAGAAGCAGG - Intronic
1064785280 10:18888054-18888076 TTGTATGAACAAATTGAAGATGG - Intergenic
1065033283 10:21610360-21610382 TGGTGTGGCCAAGAAGATGAGGG - Intronic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1065412383 10:25443738-25443760 ATGTCTCACCAAAAAAAAGAAGG - Intronic
1066114991 10:32231851-32231873 TTGTGTGGGCAAAAAGCCGAAGG - Intergenic
1070912835 10:80133137-80133159 TTGAGAGACAAAAGAGAAGAAGG + Intronic
1071947951 10:90669157-90669179 TTGTGGAAACAAAAAGAGGAGGG + Intergenic
1072064563 10:91853412-91853434 TTGAATGAACATAAAGAAGATGG - Intronic
1074659180 10:115632092-115632114 TTTTATTACTAAAAAGAAGAAGG + Intronic
1075575060 10:123572022-123572044 TTGTTTAACCAAAAACACGACGG + Intergenic
1076504653 10:130963826-130963848 TTGAGTGACTCAAGAGAAGAGGG + Intergenic
1077763532 11:5131848-5131870 GTGTGTGAAGAAAGAGAAGAAGG + Exonic
1077928830 11:6709305-6709327 TTGTGAAACCAAAAAAAAGGGGG - Intergenic
1078389465 11:10924347-10924369 TTATGTGACAGAAAAGAAGTAGG - Intergenic
1079484571 11:20922068-20922090 TAGAGTGAACAAAAAGAAGGAGG - Intronic
1080521631 11:33072453-33072475 TTCTGTGACAAAAAAGAAAGTGG - Exonic
1082932244 11:58620495-58620517 TTGGGCAACCACAAAGAAGAGGG - Exonic
1084776173 11:71377522-71377544 TTGTGTCTCCAAAAAGAATCAGG - Intergenic
1085767486 11:79295711-79295733 TTGTCTGACCCCAAAGAAGAGGG + Intronic
1086753474 11:90529145-90529167 TTCAGTGACAAAAAAGAAAAAGG - Intergenic
1087277054 11:96171149-96171171 TGGTGGGACCAGAAAGAGGATGG + Intronic
1087674716 11:101147183-101147205 ATGTGTAAACAAAAAGAAAAGGG - Intergenic
1091250419 11:134139602-134139624 TTCTGGGACTAAAAAGGAGAAGG + Intronic
1092925270 12:13266374-13266396 TTCTTTGACAAAAAAGAAGAGGG + Intergenic
1094314026 12:29117730-29117752 TTGTTTGATCAGAAAGAAAAAGG + Intergenic
1096828945 12:54300025-54300047 ATGTGTGAGAACAAAGAAGAGGG + Intronic
1098219009 12:68248700-68248722 TTTTTTAACCAAAAGGAAGATGG - Exonic
1098457169 12:70687661-70687683 TTGGGTGACCTAAAGGAAGTAGG + Intronic
1098904448 12:76147593-76147615 TTGTGAGAACAAATGGAAGAAGG - Intergenic
1098970667 12:76852441-76852463 TTGTCCAACCAAAAAGAAAAGGG + Exonic
1099187214 12:79528707-79528729 TTGTGTGTCCAAACATAAAATGG - Intergenic
1100677259 12:96880970-96880992 TTTTATGTCCAAGAAGAAGATGG - Intergenic
1100855413 12:98753287-98753309 TTGTCTGACCCAAAAGAGGCAGG + Intronic
1102649423 12:114428127-114428149 TTGTGAGACCATTAAGATGAGGG - Intergenic
1103152151 12:118650142-118650164 AGGTGTGACAAAAAAGAAGAGGG - Intergenic
1105064774 12:133186889-133186911 TTGTGTTACAAAAAAGAAGTGGG - Intronic
1105974521 13:25461821-25461843 ATGTGTGAGGAAGAAGAAGAAGG + Intronic
1106706302 13:32283464-32283486 TTGAGTTTCCAAAAAGAAAACGG + Intronic
1107032827 13:35870644-35870666 TTTTAAGACCAAAAAGGAGAAGG + Intronic
1107271802 13:38628050-38628072 TTGTGAGATCAAAAAGAACCTGG + Intergenic
1108951717 13:56102570-56102592 GTTTGTGTCCAAAAAGAAGTAGG + Intergenic
1111072765 13:83189621-83189643 TTGTGTTGCCAGATAGAAGAAGG + Intergenic
1111468871 13:88649904-88649926 TTCTGCGACCAAGAAGAATAAGG - Intergenic
1112341514 13:98556466-98556488 TAGTTTAAGCAAAAAGAAGAAGG - Intronic
1113220905 13:108100814-108100836 TTGTGGGACCAAAATCCAGATGG + Intergenic
1113310277 13:109124872-109124894 TTGTGTTACCAAAAACAATGTGG + Intronic
1114046541 14:18881052-18881074 TTGAGAGACAAAAGAGAAGAAGG + Intergenic
1114117671 14:19638396-19638418 TTGAGAGACAAAAGAGAAGAAGG - Intergenic
1114889665 14:26902364-26902386 ATGTGTGATAAAAATGAAGAAGG - Intergenic
1115146529 14:30233007-30233029 TTATTTCACCAAAAAGAACATGG + Intergenic
1115331836 14:32206041-32206063 TTCTGTGAGTAAAAAGAACAAGG - Intergenic
1117248112 14:53907200-53907222 TTGTGATACCAAGAAAAAGAAGG + Intergenic
1117452920 14:55868808-55868830 TTGAATAACCCAAAAGAAGAAGG - Intergenic
1119909873 14:78339891-78339913 TTGTGTCACTGAAAAGGAGAAGG - Intronic
1120035134 14:79688017-79688039 TTGTGGGACCAAATAGAATATGG + Intronic
1122819948 14:104336715-104336737 ATGTCTGACTAAAAAGAACAAGG + Intergenic
1124696188 15:31866553-31866575 GTGTGAGACCAAGAATAAGATGG - Intronic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1127386739 15:58473217-58473239 TTATGTGACCAGAGAGAAGCAGG + Intronic
1131759356 15:95603272-95603294 GTGAGTAACCAAAAAGAAAAAGG + Intergenic
1136538794 16:30916552-30916574 TAGTGTGACCAAAACAAAGATGG - Intergenic
1139112737 16:63911413-63911435 TTGTGTAACCAAAAACAAAATGG - Intergenic
1139465655 16:67152720-67152742 CTTTGTGACCAAAAAGAGTAAGG - Intergenic
1141932662 16:87216467-87216489 TTGTGTGGCCAACAAGAATGAGG + Intronic
1142084456 16:88169312-88169334 TTGTGTGACCAACATGGAAACGG + Intergenic
1142122847 16:88395692-88395714 CTGTGTGACCAGCAAGGAGAAGG + Intergenic
1143725517 17:8842487-8842509 TTGTGTGACAGAAATGGAGAGGG - Intronic
1144129285 17:12230167-12230189 TTATGTGTCCCAAAAGACGAGGG + Intergenic
1144334684 17:14258095-14258117 TTGTGTGAAGAAAAGGAAGGTGG - Intergenic
1146908049 17:36630484-36630506 TTGTGGGACAAGAAAGCAGAGGG + Intergenic
1148397201 17:47318619-47318641 TTCTGCGAACAAAAAGAAAAAGG + Intronic
1150506646 17:65705564-65705586 TTGAGAGAACAAAAAGAAAAAGG + Intronic
1150747523 17:67827347-67827369 TTCTGTGAGAAAACAGAAGAGGG - Intronic
1151223630 17:72632242-72632264 TTTTGTGACCAAAAAGAACCTGG + Intergenic
1152968223 18:136601-136623 TGGTGTGACCAATCAGAACACGG - Intergenic
1153605672 18:6828696-6828718 TTGTGAAACTAAACAGAAGATGG + Intronic
1153614525 18:6921921-6921943 TTCTCTGACCAGAAAGAAGTTGG + Intergenic
1156783675 18:40882539-40882561 TTCTGTGTCCAAGAAGAATAAGG - Intergenic
1158508804 18:58071328-58071350 TTGGGTGACCAAACAGAGAATGG + Intronic
1158518187 18:58148046-58148068 TTCAGTGACCAAAAAAAAAAGGG - Intronic
1158839726 18:61372072-61372094 TTGTGTGAGTGAAAAGTAGAAGG - Intronic
1159425597 18:68281399-68281421 TTTTTTCACCATAAAGAAGAGGG + Intergenic
1159442395 18:68498188-68498210 TTTTGTAACAAAAAACAAGAGGG - Intergenic
1159790317 18:72771170-72771192 TTATGTGAACAAAAGGCAGATGG + Intronic
1165931533 19:39362346-39362368 TTGTGTGACCTACTAGAAGTGGG + Intronic
926486620 2:13469086-13469108 TTGTGAAAACAAAAAGATGATGG - Intergenic
926551887 2:14310959-14310981 ATGTTTGACCTAAAAGAAGTTGG + Intergenic
927225138 2:20757276-20757298 TTGTGTGCCCATAAAAGAGAAGG + Intronic
927344023 2:22015736-22015758 TTCAGTGAGCAAAAAGAATAAGG - Intergenic
927377021 2:22429760-22429782 TTGTTTGAGTAAAAACAAGATGG - Intergenic
928853340 2:35775213-35775235 ATTTGGGACCAAAAACAAGATGG + Intergenic
929941539 2:46337666-46337688 TTGTGAGATCCAAAGGAAGAAGG + Intronic
931071604 2:58657816-58657838 TTTCCTTACCAAAAAGAAGAAGG + Intergenic
931794240 2:65694069-65694091 TTGTGTGTCAAAATAGAGGAGGG + Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG + Intergenic
935266753 2:101401535-101401557 TTGTGGGCACAAAAAGAAGAAGG + Intronic
936341759 2:111639971-111639993 TTATGTGACAAAAAGGAATAAGG + Intergenic
936416049 2:112313024-112313046 AGGTGTGACCTAAAAAAAGAAGG + Intronic
936625135 2:114140736-114140758 TTGTGTGATGAAAAGGAATAGGG - Intergenic
938266820 2:129933851-129933873 TTGAGAGACAAAAGAGAAGAAGG - Intergenic
939326667 2:140699602-140699624 TTGTGTGAAGAATAAGAAGATGG + Intronic
939513624 2:143139006-143139028 AAGAGAGACCAAAAAGAAGATGG - Intronic
939730012 2:145772271-145772293 TGGTGTGACCAATAGGTAGATGG - Intergenic
941204514 2:162554677-162554699 ATATGTGACCCAGAAGAAGAGGG - Intronic
941775182 2:169385761-169385783 TTGGGTGACCACAGAGAACAGGG + Intergenic
942122392 2:172791200-172791222 TTGAGGGACCAAATAGCAGAAGG + Intronic
945726506 2:213476880-213476902 TCCTGTGACCAAAAGGAATAAGG + Intronic
945940053 2:215940193-215940215 TAGTGTGTCAAAACAGAAGATGG + Intergenic
946482246 2:220068379-220068401 CTGTGTGTCCAACAAGAACAAGG + Intergenic
947072458 2:226305655-226305677 ATGTGTAACAAGAAAGAAGAGGG + Intergenic
947154005 2:227142814-227142836 TTGTTTTTCAAAAAAGAAGATGG - Intronic
948991164 2:241554797-241554819 TTGTGTGACCAGAGAGAGGTCGG - Intergenic
1168903271 20:1383981-1384003 TTCTGTGTCTAATAAGAAGAGGG - Intronic
1169950423 20:11037462-11037484 TTGTGTGAACCAGAAAAAGATGG + Intergenic
1171789108 20:29502205-29502227 TTATGATAGCAAAAAGAAGAAGG + Intergenic
1173343233 20:42173742-42173764 TTGTTGCACCACAAAGAAGAAGG + Intronic
1173533762 20:43792406-43792428 TTCTGTGACCCAAAAGTAAATGG + Intergenic
1177235902 21:18389765-18389787 TTTAGTGACCAAAAAGAGGTAGG - Intronic
1177249751 21:18577476-18577498 TTGTGTGACAAAGAAGGAGGAGG + Intergenic
1177269158 21:18823238-18823260 TGGTGTAACAAAAAAGATGATGG + Intergenic
1178510685 21:33202565-33202587 TTTTGTGACCACAATGCAGAAGG - Intergenic
1180465079 22:15603690-15603712 TTGAGAGACAAAAGAGAAGAAGG + Intergenic
1183447867 22:37871121-37871143 TTGTCTGAAAAAAAAAAAGAAGG + Intronic
1184835342 22:47017620-47017642 TTGTGTGACCCATCAGAAAACGG + Intronic
1184869376 22:47225588-47225610 TTGTGTGACCAAGAAGAATGAGG + Intergenic
950236850 3:11329527-11329549 TTGTATGATAAAAAAGTAGATGG - Intronic
950731885 3:14967241-14967263 TAGATTGACCAAGAAGAAGAGGG - Intronic
951283042 3:20776223-20776245 TTGTGTGACCAAGATGCAGGTGG - Intergenic
951648889 3:24926155-24926177 TTGTTTGACCAAAGAGAATGAGG + Intergenic
953795750 3:45984751-45984773 TTGTGTGAACAAAAATGAAAGGG + Intronic
954587231 3:51746372-51746394 GTGTTTGACCAAACAGATGAGGG - Intergenic
955352366 3:58203265-58203287 TAGGGGGACCAAAAAGAGGATGG - Intronic
955654284 3:61228217-61228239 TTTTATGAAGAAAAAGAAGAGGG - Intronic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
955813289 3:62814968-62814990 GAGAGGGACCAAAAAGAAGACGG - Intronic
957795833 3:85005655-85005677 TTGTTTTACCAAGAAGCAGATGG + Intronic
957968383 3:87351284-87351306 TTGTGAAAGCAAAAAGAATAAGG - Intergenic
960141343 3:114154490-114154512 CTGTCTGACCAAATAAAAGATGG - Intronic
961669824 3:128520866-128520888 TTGTGTGTCCACAATGAACATGG - Intergenic
962972934 3:140421666-140421688 CTGTGTGAGCACAAAGAACATGG - Intronic
963460773 3:145612007-145612029 TTCTGTTCCCAAAAAGAAGGTGG - Intergenic
963621588 3:147614198-147614220 ATGTGTGGCAGAAAAGAAGAGGG - Intergenic
964956943 3:162370965-162370987 CTCTGTGACCACAAAGAAGAAGG - Intergenic
965479623 3:169201903-169201925 GTGGGTGACCACATAGAAGAAGG - Intronic
966638071 3:182157627-182157649 ATGGGTGACCAAAAAGTATAGGG - Intergenic
966744158 3:183259831-183259853 TAGTGAGACCAAGAAGAAGAAGG + Intronic
967328909 3:188270784-188270806 ACATGTGACCAAAAAGAAAAGGG - Intronic
967519619 3:190414778-190414800 TCCCGTGACCAAAAAGAATAAGG + Intergenic
968476422 4:811664-811686 ATGTGTGCCTGAAAAGAAGAAGG + Intronic
969348407 4:6583422-6583444 TTCTGTTACTAAAAGGAAGAAGG + Intronic
970537111 4:17041254-17041276 TTTTCTGACCATAAAGAACAAGG - Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
970995549 4:22263562-22263584 TAGAGTGAGCAAAAAGAAAACGG + Intergenic
972090443 4:35275029-35275051 TTTTGAAACCAAAAATAAGAGGG - Intergenic
972580521 4:40391715-40391737 TTTTGTGACCAGAGAGAATAAGG + Intergenic
972644790 4:40957024-40957046 TTGTGTGACCTCAGAGAAAATGG + Intronic
974345657 4:60677850-60677872 TTGTATCCCCAAAGAGAAGATGG + Intergenic
974516659 4:62923215-62923237 TTGTATGATCAAAATGAAAATGG + Intergenic
974773066 4:66441322-66441344 ATTTGTGACCAAAAAGCAAAGGG - Intergenic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
975655230 4:76634801-76634823 TTGTGTGACTTAGAGGAAGAAGG + Intronic
975878934 4:78878699-78878721 TTGAGTAAGAAAAAAGAAGATGG - Intronic
978156617 4:105496470-105496492 TTCTATTACCAAAAAGAAGGGGG + Intergenic
978625819 4:110684084-110684106 TGGTGTCACCCAAAAGAAGTTGG - Intergenic
979776573 4:124596053-124596075 TAGTTTGACCAAAAAGAAATAGG + Intergenic
982631994 4:157842091-157842113 TTGTGGGACCATAATGAATAAGG + Intergenic
982685582 4:158484844-158484866 TTTTATGACCACAAAAAAGATGG - Intronic
982955195 4:161756125-161756147 TGGTGACACCAAAAAGAATATGG + Intronic
984005655 4:174303807-174303829 TTGTGTGATGAAAAAGCACAAGG + Exonic
984331567 4:178327384-178327406 TAGAGTGACCGAAAAGAGGAAGG + Intergenic
985812045 5:2097391-2097413 TTGTGGGGCCAAGAAGAGGAGGG + Intergenic
987649486 5:20721685-20721707 TTTTCTGACCAGAAATAAGACGG + Intergenic
987828416 5:23063533-23063555 TTGAGTTACCAGGAAGAAGAAGG + Intergenic
987855206 5:23411912-23411934 TCCTTTGACCAAAAAGAAGCAGG + Intergenic
988746072 5:34139860-34139882 TTTTCTGACCAGAAATAAGACGG - Intergenic
989141973 5:38210509-38210531 ATGTGTCACCCAAAAGAAGAAGG + Intergenic
990797818 5:59564529-59564551 TTGTCTCACCAAAAAGAGAATGG - Intronic
991121831 5:63025078-63025100 TTATTTAACCAGAAAGAAGAAGG - Intergenic
992839113 5:80669272-80669294 TCTAGTGACCAAAAAGAAGAGGG - Intronic
993153764 5:84195473-84195495 TTGTGTGACCTAATTGAAGTAGG + Intronic
993159360 5:84269032-84269054 ATGAGGGAACAAAAAGAAGAGGG - Intronic
993616849 5:90123285-90123307 TTGAGTGACTAAAGAGAAAAAGG - Intergenic
994342861 5:98652353-98652375 TAGTGTTACCTAAAAGAAGGTGG + Intergenic
994813250 5:104549926-104549948 GTATGTAACCAAAAAGTAGATGG - Intergenic
995148795 5:108818083-108818105 TTTTGTGACCAAAAATAAAATGG - Intronic
995250244 5:109984780-109984802 TTTTGTCACAAAAAAGAAGAAGG + Intergenic
996207058 5:120752533-120752555 TAGTGAGACCCAAAAGAAAAGGG + Intergenic
996938838 5:128979368-128979390 TTCTCTGGCCAAAAAGAAGAAGG + Intronic
997007161 5:129831756-129831778 TAGAGTGACTAAAATGAAGAAGG - Intergenic
997701695 5:135906420-135906442 TTAAGTAACAAAAAAGAAGATGG - Intergenic
997876961 5:137558149-137558171 TGGTGTGACCAAAAAGAGATAGG + Intronic
999664583 5:153899362-153899384 TTTTGGGACCAAACAGCAGAGGG - Intergenic
1000167760 5:158671757-158671779 GAGTGTTACCAAAAAGAAGTTGG + Intergenic
1000923452 5:167165490-167165512 TGGGGTGACCAGAAAGAAGAGGG + Intergenic
1001447078 5:171794017-171794039 TTGTGAGCCCATAAAGAACAGGG + Intronic
1002157336 5:177293647-177293669 TTCTGTGCACAAAAAGAAGCTGG + Intronic
1002962518 6:1929104-1929126 TGTTATGACCAAAAACAAGATGG + Intronic
1003332437 6:5141119-5141141 TTGTGGAAATAAAAAGAAGATGG + Intronic
1005324808 6:24689385-24689407 TTAAGTGACCCAAAAGGAGAAGG - Intronic
1005526708 6:26658579-26658601 TTTTGAAACCAAAAGGAAGATGG - Exonic
1005544228 6:26848085-26848107 TTTTCTGACCAGAAATAAGACGG - Intergenic
1007896841 6:45371293-45371315 TTATGTGACCAAAAAGAAAAAGG + Intronic
1008097884 6:47358616-47358638 TTGTCTAACCAAAGAGAACACGG - Intergenic
1008521440 6:52365125-52365147 TTGTCTCACCAAAAAAAAAAAGG + Intronic
1009015013 6:57889712-57889734 TTTTCTGACCAGAAATAAGATGG - Intergenic
1009956456 6:70460722-70460744 TAGTGTGACCAAGAGCAAGAAGG + Intronic
1010059511 6:71606354-71606376 TTGTGTCAACAAAAAGAGCATGG + Intergenic
1010971856 6:82271578-82271600 TTGTGAGGCTAAAAAGAAGAGGG + Intergenic
1012259533 6:97071657-97071679 TTGAGTGACTAGAAAGATGATGG - Intronic
1012395991 6:98797806-98797828 TTGTGTGACTCAGAAGATGAAGG - Intergenic
1012574900 6:100782465-100782487 TTGTGTTCCCAAAATGAAGCAGG - Intronic
1014040868 6:116823465-116823487 TGTTGTGACCAAAATGATGATGG - Intronic
1014296412 6:119623833-119623855 TTCTGTGACCTAAAGGAAGAAGG + Intergenic
1015013895 6:128386470-128386492 TTGGGTGACATAAAAGAGGAAGG + Intronic
1017070850 6:150574609-150574631 TTTTGTGAACAAAAAGAGGAAGG + Intergenic
1018229905 6:161665593-161665615 TTGGGTGACCTATTAGAAGATGG - Intronic
1020625475 7:10573322-10573344 TTTTCTGACTAAAAAGAAGTAGG + Intergenic
1020911331 7:14135601-14135623 TTGTCAGACCTAAAAGAATAGGG + Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023593117 7:41799758-41799780 TTGTGTGCCCATGATGAAGAGGG - Intergenic
1023949523 7:44831537-44831559 TTGTTTGAAAAAAAAGAAGCGGG - Intronic
1024188578 7:46981378-46981400 TTCTGGGACCAAAAAGAATTGGG + Intergenic
1026012845 7:66650262-66650284 GTGGGTGACCAAAATGAGGAAGG + Intronic
1026209858 7:68294535-68294557 TGGTTTGACCTAAAAAAAGACGG + Intergenic
1031044018 7:116866906-116866928 TTGTGTGAGAGGAAAGAAGATGG - Intronic
1031200735 7:118682008-118682030 TTGTGTTGCCAGAAAGAAAAAGG + Intergenic
1031332048 7:120477635-120477657 TTGGATGAAAAAAAAGAAGAGGG + Intronic
1031668201 7:124511709-124511731 TTTTGTGGCCTAAAAAAAGACGG - Intergenic
1031873676 7:127114026-127114048 GTGTGAAACAAAAAAGAAGATGG + Intronic
1032802780 7:135329741-135329763 CTGTGTCCCCACAAAGAAGAGGG - Intergenic
1033238690 7:139659079-139659101 TTGGCTGACCAAAAACAATAGGG + Intronic
1033239508 7:139665385-139665407 ATGTGAGATAAAAAAGAAGAAGG - Intronic
1034870948 7:154683481-154683503 TGGTGGGAACAGAAAGAAGAAGG - Intronic
1036558882 8:9884605-9884627 TTGTGTGAGGAAAAAAAAAATGG - Intergenic
1037318474 8:17621769-17621791 TGGAGTTTCCAAAAAGAAGATGG - Intronic
1040347825 8:46526368-46526390 TTTTGTGATTAAAAAGTAGAAGG + Intergenic
1040396328 8:47003893-47003915 TGGTATGTCCAAAAAGCAGAAGG - Intergenic
1043809632 8:84721068-84721090 TTTTGAGACTAAAAATAAGATGG + Intronic
1044833734 8:96275838-96275860 TTGAGTGATGACAAAGAAGAAGG - Intronic
1045856633 8:106771778-106771800 TTGTGTTACTAAAAACAAAAGGG - Intergenic
1046060865 8:109138069-109138091 TAGTATGACCAAAAAAAAAATGG + Intergenic
1046644589 8:116771710-116771732 TTGTTTGAAGAAAAAGAAAAAGG + Exonic
1047819672 8:128504851-128504873 ATGGGAGACCAAAAAGGAGAAGG - Intergenic
1048171230 8:132108773-132108795 TTTTATGGCCAAGAAGAAGACGG + Intronic
1049122344 8:140750498-140750520 TTGTGTGACAAAAAATAGTAAGG + Intronic
1050548464 9:6728903-6728925 TTGTATGAAAAAAAGGAAGAAGG + Intronic
1051575704 9:18613083-18613105 TTATGTGACCAAAGAGCATATGG + Intronic
1051777034 9:20646201-20646223 TTTTGTTACTAAAAAAAAGAGGG + Intergenic
1051874444 9:21776596-21776618 GTCTGTGACCAAAGAGAAGATGG + Intergenic
1052778907 9:32760533-32760555 TACTGTGAACAAAAAGAAGTGGG - Intergenic
1054796044 9:69302803-69302825 TTGTGTTAACAAAAAGCAAAGGG - Intergenic
1054964419 9:71006079-71006101 TTTTGTGACCAAAGTTAAGATGG + Intronic
1057515568 9:95717533-95717555 TTGTGTTATCAGAAAGAAGATGG + Intergenic
1057558578 9:96109221-96109243 TTGTGCAACAAAAAAGGAGAAGG - Intronic
1057682242 9:97199778-97199800 TTTTGAAACCAAAAGGAAGATGG - Intergenic
1058121133 9:101140160-101140182 TTGTGTCACCAAAAGGACTAAGG + Intronic
1059154245 9:111975939-111975961 GTGTGTGACATAAAAGCAGAGGG - Intergenic
1059751150 9:117248709-117248731 GTGTTTGATCAAAAAGCAGAAGG + Intronic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1185559376 X:1047524-1047546 TTATGTGAGCAGAAGGAAGATGG - Intergenic
1186121185 X:6362810-6362832 TTGTATGAGCAAACACAAGATGG - Intergenic
1186281154 X:7994710-7994732 TACTGTGACCAAAATGAACAGGG + Intergenic
1186906829 X:14119789-14119811 CTCTGTGTCCAAGAAGAAGAGGG + Intergenic
1187344798 X:18453152-18453174 TTGTGTGACCAAAAAGAAGAGGG - Intronic
1188327446 X:28822876-28822898 TTGTGTCACAAAAAATAACAGGG - Intronic
1188613944 X:32134123-32134145 TGCTGTGAAAAAAAAGAAGAAGG - Intronic
1188981030 X:36727372-36727394 TTGTGTGTCCTCAAAGGAGAAGG - Intergenic
1189747063 X:44180115-44180137 TTCTGTGTCCCAACAGAAGAGGG - Intronic
1193142849 X:78046879-78046901 TTATTTGACCAAAAAAAAAAAGG + Exonic
1196195473 X:112834463-112834485 ATGTGACACCAATAAGAAGAAGG + Intronic
1196274374 X:113749745-113749767 TGGTGTGACAAAAAAGACTAAGG + Intergenic
1198452888 X:136785364-136785386 TTGTGTGATAAAAAAGTACAAGG - Intergenic
1199122791 X:144076758-144076780 TTGTCTGACCAAAATGATAAAGG - Intergenic
1199466354 X:148141977-148141999 CTGTGTGGCCATAAAAAAGAAGG + Intergenic