ID: 1187344813

View in Genome Browser
Species Human (GRCh38)
Location X:18453399-18453421
Sequence TTGTCCTAATAAATGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187344813_1187344814 2 Left 1187344813 X:18453399-18453421 CCAGCAAACATTTATTAGGACAA 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1187344814 X:18453424-18453446 ACACCTATTGTCCTAATCTCTGG 0: 1
1: 0
2: 1
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187344813 Original CRISPR TTGTCCTAATAAATGTTTGC TGG (reversed) Intronic
901175881 1:7298709-7298731 TTTGCTTAATAAAAGTTTGCTGG - Intronic
901794808 1:11674002-11674024 TTGTTGTAATAAATGTTTTCAGG + Exonic
904637057 1:31890351-31890373 CTGTTCTATTAAATATTTGCCGG + Intergenic
907861488 1:58357905-58357927 TTGGTCTCATAAATGTTTACGGG - Intronic
909193248 1:72581991-72582013 TTATTATAATAAATGTTTGGAGG + Intergenic
910408864 1:86918722-86918744 TAGTGCTAATGAATGTGTGCTGG - Intronic
911687768 1:100796738-100796760 TCATCCTTATAAATGTTTGTTGG - Intergenic
911814349 1:102326134-102326156 TTCTGCAGATAAATGTTTGCTGG - Intergenic
912048486 1:105491353-105491375 TTATCCTAATAATCATTTGCTGG + Intergenic
912237433 1:107867164-107867186 TTGTCCTAAGAAATGTTAATAGG - Intronic
912306684 1:108574827-108574849 TTGGCCTAATAAACATTTGGAGG - Intronic
912663154 1:111552919-111552941 TAGCTTTAATAAATGTTTGCTGG - Intronic
913120293 1:115734116-115734138 TTGTCCTCATAAAAGTAAGCAGG + Intronic
916855042 1:168740392-168740414 TTATCCTAAAAAATGCTTTCAGG + Intergenic
919059430 1:192612697-192612719 TGTTTCTATTAAATGTTTGCTGG - Intergenic
919302949 1:195793139-195793161 TTGTCCTTAAAAATTTTTTCAGG - Intergenic
1065409989 10:25415064-25415086 TTCTCCTAATAAAAGTTTCTTGG - Intronic
1066692978 10:38050074-38050096 TGGTACTATTAATTGTTTGCTGG - Intronic
1066999799 10:42598959-42598981 TGGTACTATTAATTGTTTGCTGG + Intronic
1067537977 10:47129595-47129617 TTTTTCTAGTTAATGTTTGCAGG - Intergenic
1068777015 10:60878762-60878784 TTGTCCATATAAATGCATGCTGG + Intronic
1071777949 10:88810175-88810197 TGGTGCTAATAAATATTTGCGGG + Intronic
1072277737 10:93839366-93839388 TTGTGCTAATTAATGTCTGCTGG + Intergenic
1077161763 11:1116590-1116612 TTTTCCTTCTAAATGTTTTCAGG - Intergenic
1079705609 11:23613720-23613742 ATGTCATGATAGATGTTTGCTGG - Intergenic
1081216276 11:40402862-40402884 TTGTCCTAATAGCTGGTTGTGGG + Intronic
1081881418 11:46456112-46456134 TTGTCTTAAATAATGTTTGTGGG - Intronic
1083498974 11:63085840-63085862 TTCTGCTCATATATGTTTGCAGG - Intronic
1085947761 11:81292379-81292401 TTGTCCTATTAAATGATTATAGG + Intergenic
1087281696 11:96218047-96218069 TTTTCCTACTAAATGATTCCAGG + Intronic
1088003526 11:104911993-104912015 TTGTTCTAAAAAATTTTTGGTGG - Intergenic
1090111452 11:123914056-123914078 TTGACCTAATAGATATTTACAGG + Intergenic
1090676637 11:129004368-129004390 TAGACCTAATAAATATTTACAGG - Intronic
1092846898 12:12591973-12591995 TTATCCTAGTAAATATTTGTAGG - Intergenic
1093825601 12:23683627-23683649 TTCTCCTGTTAAATCTTTGCAGG - Intronic
1094423604 12:30297104-30297126 GTGTCTTAAGAAATGCTTGCTGG + Intergenic
1095479238 12:42617847-42617869 CTGTCCTGATAAATGTTTTAAGG - Intergenic
1097066133 12:56322110-56322132 TTGACATAATAAAGGATTGCAGG + Exonic
1097909848 12:64958114-64958136 GTGTTCCAATAAATGTTTTCAGG - Intergenic
1098101584 12:67023640-67023662 TTCTACTAAAAAATGTCTGCTGG + Intergenic
1099050248 12:77773718-77773740 TTGTCAAAATACATATTTGCGGG - Intergenic
1100018653 12:90043070-90043092 TTTTCCAAATAAAGCTTTGCTGG + Intergenic
1100168474 12:91945567-91945589 TTGTCATCTAAAATGTTTGCAGG - Intergenic
1100775524 12:97969057-97969079 TTGACCCAATATATATTTGCTGG + Intergenic
1100860861 12:98805136-98805158 TACTCCTAATAAATGTCTTCAGG + Intronic
1101220795 12:102637693-102637715 TTTTCCTAATAAACTATTGCAGG - Intergenic
1102522402 12:113486687-113486709 TTCTCCTAATAGATGTTTGTTGG - Intergenic
1105741287 13:23326092-23326114 TTGTCATAGTAAATGGTTCCTGG + Intergenic
1106258487 13:28043292-28043314 TGGTCCTGATAAAGGTTTCCAGG - Intronic
1106332921 13:28755572-28755594 TTGTCCTACTAAATGGTTTGTGG + Intergenic
1107065351 13:36208834-36208856 TTGACCTTATAAGTATTTGCTGG - Intronic
1107310432 13:39072121-39072143 TTCACTTAAAAAATGTTTGCTGG - Intergenic
1109914201 13:68959106-68959128 TTGTCCTATTAAATAATTGGAGG + Intergenic
1110771473 13:79353102-79353124 TTGGCTTCATAAATGTTTTCAGG - Intronic
1114749062 14:25183130-25183152 TTTTCCTGAAAACTGTTTGCAGG - Intergenic
1115295195 14:31818046-31818068 TTGTCTTTTTAAATCTTTGCTGG - Intronic
1117074844 14:52091641-52091663 TCCTGCTAATAAATTTTTGCCGG + Intergenic
1117203485 14:53416828-53416850 TACTCCAAATAAATGTTTGAGGG + Intergenic
1120833596 14:89020589-89020611 TTGTTCTAATAAATTTTTAGTGG + Intergenic
1121365109 14:93301939-93301961 TTTGCCTAATAAATCTTTACTGG - Intronic
1124457437 15:29857370-29857392 TTGCCCTGAGAAATGTGTGCTGG - Intronic
1124842945 15:33261659-33261681 TTATCTTAATAAATGTTTGGTGG + Intergenic
1126028184 15:44469304-44469326 TTGTACTTATAAATGGTTGGAGG - Intronic
1129569249 15:76661559-76661581 TTTTTTTAATATATGTTTGCTGG - Intronic
1133905148 16:10015694-10015716 TGTTCCCAATAAATGTTTGCTGG - Intronic
1134176766 16:12013220-12013242 TTTTCCTAATATATGTTTGCTGG - Intronic
1135509823 16:23072723-23072745 TTGCCCTAATAAATATTTAAGGG - Intronic
1138502225 16:57454352-57454374 TTGTCCTATTAAAGGGTTGGAGG + Intronic
1138651204 16:58462831-58462853 TTGTCCAAATAAAATTTTTCAGG + Intronic
1140924675 16:79570819-79570841 TATTCCCAGTAAATGTTTGCTGG - Intergenic
1143048058 17:4098721-4098743 TTGTCTTTATAAATTTTTGTTGG - Intronic
1145303846 17:21659461-21659483 TTGTGCTGATTAGTGTTTGCAGG + Intergenic
1145346187 17:22042360-22042382 TTGTGCTGATTAGTGTTTGCAGG - Intergenic
1145728042 17:27152006-27152028 TTTCACTAATAAATTTTTGCTGG - Intergenic
1147854494 17:43468643-43468665 TTCTTCAAATAAATGCTTGCTGG - Intergenic
1148918362 17:51004424-51004446 TTCTTATAACAAATGTTTGCAGG - Intronic
1155226029 18:23730008-23730030 TTGTCCAAATGGATCTTTGCAGG - Intronic
1155234501 18:23805833-23805855 TTTACCTTATAAATGTTTGGCGG + Intronic
1156332084 18:36131902-36131924 TTGTCCTGTTAAATATTTGCTGG + Intronic
1158700155 18:59738081-59738103 TTGGCCTAATAAATCCTTCCTGG - Intergenic
1159264836 18:66067020-66067042 TTGCCCTACTACATGTTTGTAGG + Intergenic
1162252413 19:9456804-9456826 TTGTTGTAATAAATGTATGGGGG - Intergenic
1165001997 19:32771967-32771989 TTTCCCTCATAAATGATTGCCGG + Intronic
928438134 2:31269143-31269165 TTTCCCTATTAAATGTTTCCTGG - Exonic
930395973 2:50825302-50825324 GTATGCTAATGAATGTTTGCTGG + Intronic
932854783 2:75221741-75221763 TTGTCTTATTTAATGTTTGTGGG + Intergenic
933225544 2:79744709-79744731 TTGTCATTTTTAATGTTTGCTGG + Intronic
935136030 2:100303113-100303135 TTGTTCTAATAAATTTGTTCAGG - Intronic
935244690 2:101207756-101207778 TTGTCCAGAGAAATGTTTGGTGG - Intronic
937502959 2:122503054-122503076 TTGTCCTACTTGATGTTTGCAGG + Intergenic
940481568 2:154239733-154239755 TTTTTCAAATAAATGTATGCTGG + Intronic
941725725 2:168858162-168858184 TGATCCTAATACATGTATGCTGG - Intronic
942307212 2:174620610-174620632 TAGACCTAGTAAATGTTGGCTGG - Intronic
943163922 2:184292403-184292425 TTGTCTTAATAACTCTTTTCTGG - Intergenic
945131851 2:206582172-206582194 ATGACCTAAGAAATGTTGGCCGG - Intronic
945454827 2:210038271-210038293 TATTCCCAATAAATGTTTACTGG - Intronic
945724650 2:213461763-213461785 TTATCCTATTATATCTTTGCTGG - Intronic
1171521377 20:25777104-25777126 TTGTGCTGATTAGTGTTTGCAGG + Intronic
1171555434 20:26078767-26078789 TTGTGCTGATTAGTGTTTGCAGG - Intergenic
1172463489 20:35137651-35137673 TTGACCTCATTATTGTTTGCAGG - Intronic
1174297947 20:49562256-49562278 TTCTCCTAAAACATCTTTGCAGG + Intronic
1184394816 22:44227438-44227460 TTGTCATAATAAATGGTTGTTGG - Intergenic
1185176802 22:49332323-49332345 TTGTGAAAATGAATGTTTGCTGG - Intergenic
956956075 3:74342299-74342321 TTTTCCTAAATACTGTTTGCAGG - Intronic
957467849 3:80618677-80618699 TTGTACTACCAAATCTTTGCTGG + Intergenic
958972887 3:100632828-100632850 TTGCCTCAATAAATGTTTGCTGG - Intronic
960335718 3:116415309-116415331 TTGTTCAAAAAAATGGTTGCCGG + Intronic
961799157 3:129431647-129431669 TTGGCTTTTTAAATGTTTGCTGG + Intronic
965143319 3:164866526-164866548 TAGTTCTAATAAATTTTAGCAGG - Intergenic
965248532 3:166309342-166309364 ATGTGCTTATAAATGTGTGCAGG + Intergenic
966719986 3:183053057-183053079 TTGTCCCAATAAAAGTTTTCAGG - Intronic
967019468 3:185509897-185509919 TTGTACTATTAAATGTTTTAAGG + Intronic
970214710 4:13746552-13746574 TTTTCCTAAACCATGTTTGCAGG + Intergenic
970512997 4:16799468-16799490 TCTTCCTATTCAATGTTTGCAGG - Intronic
970875853 4:20869137-20869159 TAGTTATAATAAATTTTTGCTGG + Intronic
971106797 4:23534839-23534861 TTTTTCTAAAATATGTTTGCTGG - Intergenic
972068937 4:34990486-34990508 TTGTGTTAATAAATGTTTTTAGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972629723 4:40832838-40832860 CGGTACTAATACATGTTTGCGGG + Intronic
972827985 4:42783918-42783940 TTGTCTTTTTAAATCTTTGCTGG + Intergenic
974932246 4:68372532-68372554 TTGTCCTATTAAATCTTCCCAGG - Intergenic
977346837 4:95826573-95826595 AGGTCCTAAAAAATGTTGGCAGG - Intergenic
978301274 4:107271240-107271262 TTCTCCTTATAAATGTTTCTTGG + Intronic
978811891 4:112858974-112858996 TCTTGCTAATAAATGTTTGTAGG - Intronic
979036347 4:115724327-115724349 TTGTCTGAATAAATTTTAGCAGG - Intergenic
979134068 4:117086102-117086124 TTGACCTAGTAAATATTTCCAGG - Intergenic
979152698 4:117340801-117340823 TTGTCTTTTTTAATGTTTGCTGG + Intergenic
980185302 4:129453811-129453833 TTTTCCTAATCAGTGATTGCTGG - Intergenic
980464960 4:133162854-133162876 TTGTCTTAACAAATTTTTCCTGG - Intronic
980772990 4:137402759-137402781 TTATCCTAATATATCTTTCCAGG - Intergenic
981417667 4:144512045-144512067 TTGTTATAATAGATGTTTGTTGG - Intergenic
982363880 4:154553677-154553699 TTGTACTTACAAATATTTGCAGG + Intergenic
983185830 4:164699609-164699631 TTCTCCTCATAAATCTTTGTTGG - Intergenic
983839923 4:172444818-172444840 CTCTCCTAATAAATGTGTTCAGG - Intronic
985032739 4:185806908-185806930 TTGTCCTAGTACATTTTTTCTGG - Intronic
985292249 4:188398599-188398621 TTGTCCTAATTAAAGTTCTCGGG + Intergenic
986175523 5:5348852-5348874 TTGTCCTAAAAAAGATTGGCTGG - Intergenic
986745490 5:10740758-10740780 TTGTGATAGTAAATGTCTGCTGG - Intronic
986847143 5:11768722-11768744 TTGTCCTCACAAATGATTGCAGG - Intronic
987463680 5:18246742-18246764 TTGTCATAATCAATTTTTCCGGG - Intergenic
989400487 5:41002923-41002945 TTGTCCTCAAAAATGCTTACTGG - Intronic
989418998 5:41213549-41213571 TTGTCAAAATAAATGTTCTCTGG + Intronic
989794819 5:45454920-45454942 TCATCCCAATAAATGTGTGCTGG - Intronic
991037058 5:62138155-62138177 TTGTCCTCACAAATGCTTTCTGG + Intergenic
991160748 5:63498974-63498996 TTGTCCTAAATAATTTTGGCTGG + Intergenic
993440477 5:87950725-87950747 TTCTCCCAAGAAATGTTAGCAGG - Intergenic
994000894 5:94777967-94777989 TTTTCCTAATCAATGCTTGAAGG - Intronic
995105307 5:108370794-108370816 TGGGCTTAATACATGTTTGCTGG - Intronic
995649946 5:114359799-114359821 GCGTCCTAATACATGTTTGATGG + Intergenic
995843865 5:116472132-116472154 TTACCCTAATAAATATTTGGGGG + Intronic
996276808 5:121676592-121676614 TTGTCCTAATAATTATTCTCTGG - Intergenic
998855545 5:146391810-146391832 TTTTCCTAAAGAATGTTTCCAGG + Intergenic
999352519 5:150888197-150888219 TTGTCTTTCTAAATCTTTGCTGG - Intronic
999869983 5:155739655-155739677 TTGACTGAATAAATGTTTACTGG - Intergenic
999980668 5:156954823-156954845 TTGTGCTAATAGATGCTTCCAGG + Intronic
1001244488 5:170095715-170095737 ATGTCCTCATTAATGTCTGCAGG - Intergenic
1001363533 5:171112798-171112820 ATATCTTAATAAATGTTTACAGG - Intronic
1001521036 5:172393431-172393453 TTGTCCTAATATTTTTTTGATGG + Intronic
1001776793 5:174334867-174334889 GTTGCCTAATAAATGTTTGCTGG + Intergenic
1003002361 6:2348022-2348044 CTTTTCTAATAAATATTTGCTGG - Intergenic
1003821287 6:9899930-9899952 TTTTCCAAGTAAATGTATGCTGG + Intronic
1004127686 6:12889409-12889431 ATGTCCTAATCAATGCGTGCTGG + Intronic
1007848784 6:44783274-44783296 GTGTCATAATAAATGTTTTGGGG + Intergenic
1011120846 6:83950969-83950991 TTGTGATAATAAATGTTTCTGGG - Intronic
1012748557 6:103126498-103126520 TAGTTCTAATAAATTTTTGGTGG + Intergenic
1012815307 6:104016762-104016784 TTGCACAAATAGATGTTTGCTGG - Intergenic
1014650392 6:124029520-124029542 AGGTACCAATAAATGTTTGCTGG - Intronic
1015826852 6:137322771-137322793 TTGTCCTTATAAATTTGAGCTGG - Intergenic
1017281858 6:152634564-152634586 TATTACTAATAAATGTGTGCAGG + Intronic
1017430697 6:154367879-154367901 TTTTCCTAATAAGTGTATGAGGG - Intronic
1018069409 6:160149155-160149177 ATGTCCTAATAATTGTTCACTGG - Intronic
1018841845 6:167523047-167523069 TTTTCCTGAGAGATGTTTGCAGG - Intergenic
1019652517 7:2167944-2167966 TTGCCAAAATAAATCTTTGCAGG - Intronic
1023022054 7:36019401-36019423 TTGTGCTAAGAAATGGTGGCAGG + Intergenic
1024367742 7:48541326-48541348 TAGTCCAAGTAAATGTTTGATGG - Intronic
1025281844 7:57632064-57632086 TTGTGCTGATTAGTGTTTGCAGG + Intergenic
1025302885 7:57833453-57833475 TTGTGCTGATTAGTGTTTGCAGG - Intergenic
1028205348 7:88010533-88010555 TTTTCTTAAAAAATGATTGCAGG + Intronic
1029534823 7:101150865-101150887 TTGACCTAATAAATAGCTGCCGG + Intergenic
1039659020 8:39442945-39442967 TTGTTCAAATACATGGTTGCAGG + Intergenic
1041209298 8:55532223-55532245 TTGACCTAATAAATGTTACAAGG + Exonic
1042035699 8:64531629-64531651 TTATCCTAATAATTGTTTCCAGG - Intergenic
1042037668 8:64553938-64553960 TTGTCTTAGTTAATGTTTTCTGG + Intergenic
1042966450 8:74358701-74358723 TTTTCCTAAAACATGTTTGGGGG - Intronic
1043823639 8:84898870-84898892 GTGTCCTAACAGAGGTTTGCAGG - Intronic
1044192487 8:89335387-89335409 TTGTCTTAATTAATTTTTACGGG + Intergenic
1045517585 8:102873901-102873923 TTCTATTAATAAATGGTTGCAGG + Intronic
1045838324 8:106549990-106550012 TTGTGCTAATAAACATTTCCTGG + Intronic
1046734173 8:117758440-117758462 CTGGCCTAATAAATTGTTGCTGG - Intergenic
1048292841 8:133193623-133193645 TGTGCCTAATAAATGTTTGTTGG - Intronic
1048477214 8:134754549-134754571 TTGTCTTAATATCTGTTTGAGGG - Intergenic
1050672255 9:8010706-8010728 TGAACCTGATAAATGTTTGCAGG + Intergenic
1052631386 9:31045632-31045654 TTGGCTTAATAAAAGCTTGCTGG + Intergenic
1059968511 9:119640165-119640187 CTGTCCGAATAAATGTGTGCTGG + Intergenic
1061604143 9:131695837-131695859 TTTTTTTATTAAATGTTTGCTGG - Intronic
1061891069 9:133620104-133620126 TTGTGCTAATAAATCTTCACTGG - Intergenic
1186935624 X:14447939-14447961 ATTTCCTAATAAAAGTTTGTTGG - Intergenic
1187344813 X:18453399-18453421 TTGTCCTAATAAATGTTTGCTGG - Intronic
1188409403 X:29852494-29852516 TTGTCCCAAAAAAAGTTTGGTGG - Intronic
1189087009 X:38036007-38036029 TTGTATTAATAATTGTTGGCTGG + Intronic
1190869826 X:54415504-54415526 TTGTCCTAAGAAAGGTTAGTTGG + Intergenic
1190968466 X:55325830-55325852 TTTTCCTAAATAATGTTTGATGG - Intergenic
1193128449 X:77894826-77894848 TTGTCCAAATAATTGTTTCAAGG - Intronic
1193282128 X:79665103-79665125 TTGTCCTTCTTAATTTTTGCTGG - Intergenic
1194224633 X:91241043-91241065 TTGTAATTATAAATGTATGCTGG + Intergenic
1194705859 X:97174812-97174834 TCTTCCTAATAAATGTTTAAAGG - Intronic
1196360958 X:114857420-114857442 TGGTCCTAATAATTGTGTTCTGG + Intronic
1199041248 X:143117574-143117596 TTGTGTGTATAAATGTTTGCCGG - Intergenic
1200365968 X:155664077-155664099 TTGCCCTTATAAATGCTTGAGGG - Intronic
1200561096 Y:4704353-4704375 TTGTAATTATAAATGTATGCTGG + Intergenic