ID: 1187345944

View in Genome Browser
Species Human (GRCh38)
Location X:18463880-18463902
Sequence GAGCTAGCTGCCTATTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187345944_1187345946 12 Left 1187345944 X:18463880-18463902 CCTTTAAAATAGGCAGCTAGCTC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1187345946 X:18463915-18463937 ATGAGCCACAAGCAAAGATGTGG 0: 1
1: 0
2: 1
3: 20
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187345944 Original CRISPR GAGCTAGCTGCCTATTTTAA AGG (reversed) Intronic
906975697 1:50570129-50570151 GAGCTAGAGGCTTATTCTAAGGG - Intronic
910344658 1:86222445-86222467 GAAGTAGCTGCATAATTTAATGG + Intergenic
918656548 1:187033674-187033696 GAGCAAGCTGCCTGCTTTAATGG - Intergenic
920781658 1:208997589-208997611 GGGCTGGTTGCCTATTTTTATGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923121430 1:230995759-230995781 GAACAAACTGCCTATTTTATTGG + Exonic
924256172 1:242185087-242185109 CAGCTGGCTGCCTATGTTTATGG + Intronic
1070232647 10:74586202-74586224 GAGCCAGCTGCCTTCTCTAATGG + Intronic
1071373798 10:84982132-84982154 GAGCTGGTTGCCTTTTTGAAGGG - Intergenic
1076372053 10:129961793-129961815 GAGTTAGCTGCCTTTGTTATAGG + Intronic
1077937702 11:6806482-6806504 GATTTAGCTCCCAATTTTAAGGG + Intergenic
1079737014 11:24010115-24010137 GAGATAGCTGCTAATTTCAAAGG + Intergenic
1079984572 11:27187196-27187218 GAGGTAGCTGCCTACTTGTAAGG + Intergenic
1080915015 11:36648612-36648634 GAGCCACCTGCTCATTTTAAGGG - Intronic
1087573193 11:99957024-99957046 GAGTTGGCTGACCATTTTAACGG - Intronic
1089419077 11:118317485-118317507 GAACTAGCAGCCAATTTTAATGG + Intergenic
1091366178 11:135022516-135022538 CAGCTAGTTGGCTATTTTTATGG + Intergenic
1093612206 12:21174786-21174808 AAGGTAACTGCCTATTTAAAGGG - Intronic
1094053031 12:26241114-26241136 GAGCTACTTGCCTACTTTACAGG + Intronic
1096355156 12:50934875-50934897 GAGCCAAATGCTTATTTTAATGG + Intergenic
1101207347 12:102501746-102501768 GAGCTTGCTTTCTATCTTAAAGG - Intergenic
1105986129 13:25569490-25569512 TAGCCAGTTGCCTATTTAAAAGG + Intronic
1110779401 13:79447366-79447388 GAGTTCGCAGCTTATTTTAATGG - Intergenic
1112693428 13:101919965-101919987 AACGTAGCTTCCTATTTTAAGGG + Intronic
1114283456 14:21216912-21216934 TAGCTAGCTAGCTAGTTTAACGG - Intronic
1115240163 14:31245811-31245833 GAACTAGCTGCTTTTTTTCAAGG - Intergenic
1115268238 14:31524193-31524215 AAGCTAGAAGCTTATTTTAAGGG + Intronic
1115405225 14:33007434-33007456 GGGATAACTTCCTATTTTAAAGG + Intronic
1118328628 14:64798870-64798892 GAGCTAGAAGCCTATTTCAGAGG + Intronic
1118970779 14:70635731-70635753 GAGCAAGCAGCCTATACTAAAGG + Intergenic
1119174139 14:72556898-72556920 GATATAGCTTCCTATTTAAAAGG + Intronic
1123990941 15:25682810-25682832 GCACTTGCTGTCTATTTTAATGG + Intronic
1125785281 15:42311161-42311183 AAGCCAGTTGCATATTTTAATGG - Intronic
1126930345 15:53641584-53641606 GAGCAAGCACACTATTTTAAAGG - Intronic
1127724632 15:61737118-61737140 GACCAAGCTGCCTGTTTGAAGGG + Intergenic
1129762726 15:78140210-78140232 GAACTAGCTGCCCCTTTCAAAGG - Intronic
1131203800 15:90424507-90424529 GAGTACGCTGCCTAATTTAAAGG + Intronic
1131389852 15:92038368-92038390 GAAGTAGCTGGCTATTTTAAAGG + Intronic
1134393230 16:13839141-13839163 GAGCAAGGTGCTGATTTTAAAGG + Intergenic
1136011331 16:27365172-27365194 TTGCTGGCTGCCTATTTTTATGG + Intergenic
1139143623 16:64297810-64297832 CAGCTATCTGCCTACTCTAACGG - Intergenic
1145019831 17:19420967-19420989 GGGCTCGCTGAATATTTTAATGG - Intergenic
1150155608 17:62850592-62850614 GAGCTCGGTGCCTATTGAAAAGG - Intergenic
1156847613 18:41686370-41686392 GATCTAGATGCCTATCTTTATGG - Intergenic
1157487037 18:48095348-48095370 GAACAAGCTGCCTATTTGAGAGG + Intronic
1159147764 18:64476890-64476912 GAGCTAGCTGCATAATTTGTAGG + Intergenic
1164470717 19:28529020-28529042 CTGCTAGCTGCCCATTTTTATGG - Intergenic
926091059 2:10049895-10049917 GACCTGCCTGCCTCTTTTAATGG + Intronic
927719784 2:25375177-25375199 GAGTCAGCCGTCTATTTTAAAGG - Intergenic
928700627 2:33895280-33895302 CAGCTAGTTGCCCATTTTTATGG - Intergenic
930305357 2:49668491-49668513 GAGATAGCTGCCTAACTAAAAGG - Intergenic
932113768 2:69025976-69025998 GAAATGGCTGCCCATTTTAATGG - Intronic
932772595 2:74508773-74508795 GAGCTAGCGGACTTTTTTGAAGG + Intergenic
935108779 2:100072565-100072587 GAGCTAGCTGCCTGTCCTACTGG + Intronic
938822938 2:134977099-134977121 GAGATTTCTGCATATTTTAAAGG - Intronic
939096621 2:137839889-137839911 GTCCCATCTGCCTATTTTAAGGG + Intergenic
942641447 2:178065202-178065224 TTGCTTGCTGCTTATTTTAAGGG - Intronic
942716069 2:178893577-178893599 TAGCTTGCTGCTTCTTTTAATGG + Intronic
944314966 2:198274658-198274680 GAGATAGCTGTGTATTTTTATGG + Intronic
944893848 2:204144257-204144279 GAGATAGCTGCATATTCTAATGG + Intergenic
946295291 2:218779068-218779090 TTCCTAGCTGCCTGTTTTAAGGG + Intergenic
1170148578 20:13204743-13204765 GAAGTAACTGCCAATTTTAAAGG + Intergenic
1170957297 20:20992839-20992861 CAGATTGCCGCCTATTTTAAGGG - Intergenic
1178692752 21:34763411-34763433 GAGGTAACTGCACATTTTAAAGG + Intergenic
1178744606 21:35236947-35236969 GAGCAATCAGCCCATTTTAATGG + Intronic
1183004265 22:34887907-34887929 GAGGTAGATACCTATTTTACTGG - Intergenic
952038035 3:29227333-29227355 AAGCTAGCTGTGTATTTCAAAGG + Intergenic
961041421 3:123681271-123681293 GAGGTAGCTGCCTATGGTCACGG + Intronic
961930137 3:130524267-130524289 GAGCTGTCTGCACATTTTAAGGG + Intergenic
963190863 3:142471554-142471576 GAGCTAGCAGGTTTTTTTAAAGG + Intronic
965422936 3:168484863-168484885 CAGCTGGCTGCATTTTTTAAAGG + Intergenic
966242120 3:177766254-177766276 GAGCAGTCTGCCCATTTTAAAGG + Intergenic
966559538 3:181304546-181304568 GAGGTAGCTGCAAATTCTAATGG - Intergenic
967905547 3:194496630-194496652 AAGCTAGCTGCCTGTTTTTGTGG + Intronic
968805019 4:2766704-2766726 GGGAAAGCTCCCTATTTTAAGGG - Intergenic
975061532 4:70008772-70008794 GATCTTTCTTCCTATTTTAATGG - Intergenic
978660008 4:111114650-111114672 GAGATCACTGGCTATTTTAATGG - Intergenic
978738515 4:112111708-112111730 GATCTGGCTTCCTATTTTACAGG - Intergenic
979860972 4:125693334-125693356 AAGCTAGCTGTCTATTTCTAAGG - Intergenic
983044783 4:162973157-162973179 CTGCTGGCTGCCTATTTTTATGG - Intergenic
983918577 4:173319066-173319088 TAGCTAGTTGCTTACTTTAATGG + Intronic
985872430 5:2568200-2568222 GTGCTTGCTGCCTATTTTGGGGG - Intergenic
988417386 5:30962706-30962728 GGGCTAACTGCCAATTCTAATGG - Intergenic
991381557 5:66033564-66033586 TAGCTAGCTGCCAAATATAATGG - Intronic
999365144 5:151018671-151018693 TTGCTAGGTGCCTATTTTGAGGG + Intergenic
1001459224 5:171894722-171894744 GGGCTACCTGCCAGTTTTAAAGG - Intronic
1004730300 6:18351337-18351359 GAGATAACTGCATATTTAAAGGG - Intergenic
1008415215 6:51232039-51232061 GAGGGAGCTTACTATTTTAAAGG + Intergenic
1008734464 6:54526173-54526195 GACCTAGGTGCCCATTTTAATGG + Intergenic
1012957017 6:105581939-105581961 GAGCTAGCTGCTTTCTTGAATGG + Intergenic
1015639854 6:135319636-135319658 GAGCTATGTGCAAATTTTAAAGG + Intronic
1024129120 7:46332285-46332307 GATCTAGGAGCCTTTTTTAAAGG + Intergenic
1024832094 7:53472861-53472883 GAGCTCGTTGCCTATTTTTCTGG - Intergenic
1029050114 7:97677433-97677455 GAGCTACCTAACTCTTTTAATGG - Intergenic
1030641897 7:112015397-112015419 CTGCTAGCTGGCTATTTTTATGG - Intronic
1030702404 7:112655855-112655877 GAATTAGCAGCCTATTTGAATGG - Intergenic
1031022845 7:116647087-116647109 GAGCTACATGCCCAGTTTAAGGG - Intergenic
1032785620 7:135197299-135197321 GGGCTATTTGCCTGTTTTAAAGG - Intronic
1033419987 7:141197051-141197073 GTGCTTGCTGCATATCTTAAAGG + Intronic
1034200946 7:149282444-149282466 CAGCTAGCTTCCCATTTGAATGG - Exonic
1036611823 8:10356931-10356953 GGGCAAGCTGCGTGTTTTAAAGG - Intronic
1042789151 8:72584176-72584198 GATCTAGATACCTTTTTTAAGGG + Intronic
1045371346 8:101526708-101526730 AAACTAGCTGCTTTTTTTAAGGG - Intronic
1045738756 8:105328561-105328583 TAGCTGGCTTCCTACTTTAATGG - Intronic
1046034982 8:108829795-108829817 GGGAGAGCTGCCTATTTAAAGGG + Intergenic
1051357452 9:16252869-16252891 GAGCTTGCTGGCAAATTTAAGGG + Intronic
1061769740 9:132909606-132909628 GAAGTAGCTGCCTTTTTTCATGG - Intronic
1187345944 X:18463880-18463902 GAGCTAGCTGCCTATTTTAAAGG - Intronic
1188235497 X:27725981-27726003 GAGTTAGCAACCTATCTTAATGG + Intronic
1199124309 X:144096743-144096765 GAACTAGCTGCCTTTATTCATGG - Intergenic
1200912684 Y:8545127-8545149 GAGATTCCTGCCCATTTTAAAGG - Intergenic