ID: 1187352617

View in Genome Browser
Species Human (GRCh38)
Location X:18534899-18534921
Sequence TTAGGGAGAAGGAGCGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 699}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187352612_1187352617 1 Left 1187352612 X:18534875-18534897 CCTGGTGTGAGCAATTTTCTTTC 0: 1
1: 1
2: 1
3: 55
4: 681
Right 1187352617 X:18534899-18534921 TTAGGGAGAAGGAGCGAGGAAGG 0: 1
1: 0
2: 5
3: 51
4: 699

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187352617 Original CRISPR TTAGGGAGAAGGAGCGAGGA AGG Intronic
900384063 1:2401348-2401370 GGAGGGAGGAGGAGGGAGGAAGG - Intronic
900384071 1:2401369-2401391 GGAGGGAGGAGGAGGGAGGAAGG - Intronic
900969060 1:5979419-5979441 TTGGGGAGAGGGAGCCAGGCAGG + Intronic
901037917 1:6347316-6347338 ATCCGGAGAAGGAGCAAGGAGGG + Intronic
901409850 1:9075077-9075099 TTAGGGAAAAGGAGTCAGGTTGG + Intronic
901458049 1:9375027-9375049 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
901670614 1:10854106-10854128 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
901862045 1:12080800-12080822 TTTGGGAGAATGAGACAGGAGGG - Intronic
902373039 1:16017316-16017338 TTAGGGAGAAACAGCTAGGGGGG - Intronic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
903025706 1:20428680-20428702 ACAGAGAGAAGGAGGGAGGAAGG + Intergenic
904265303 1:29315295-29315317 CTAAGGAGAAGAAGAGAGGAGGG - Intronic
904819604 1:33233215-33233237 TTAGGCAGAAGGAGCAATCAGGG - Intergenic
905703232 1:40035149-40035171 TAAGGGACAAGGAAAGAGGAAGG - Intergenic
905942918 1:41878682-41878704 AGAGGGAGGAGGAGGGAGGAGGG - Intronic
906291872 1:44624666-44624688 ACAGGGAGAAGGAGGGAGGGAGG + Intronic
906450739 1:45945055-45945077 TTAGGGAGACTGAGGCAGGAGGG + Intronic
906615062 1:47228368-47228390 TTGGGGAGAATGAAGGAGGAGGG + Intronic
906702352 1:47869047-47869069 TTTGGGGGAAGGAGGGAGGGAGG - Intronic
907110415 1:51921865-51921887 ATAGGGAGAAAGAGGGAGGGGGG - Intronic
907723978 1:57001580-57001602 TGAGTGACAAGGAGCCAGGAGGG - Intronic
909056267 1:70824802-70824824 TATGGGAGAAGCAGAGAGGAGGG - Intergenic
909328521 1:74383453-74383475 TTATGGAGAAAGTGTGAGGAGGG - Intronic
909367377 1:74843513-74843535 TTAGGGATAAGCAGCAAAGAAGG + Intergenic
909614473 1:77591325-77591347 AGAGGGAGAAGGAGAGAGGGAGG - Intronic
909776840 1:79493001-79493023 TAAGGGAGAAGGAGCAATGGAGG + Intergenic
910332999 1:86097522-86097544 GGAGGGAGGAGGAGGGAGGAGGG - Intronic
910333006 1:86097539-86097561 GAAGGGAGGAGGAGGGAGGAGGG - Intronic
910336602 1:86139163-86139185 TGAGGGAGAAGGAGAAAGGGGGG + Intronic
910480246 1:87650830-87650852 GTAGGGAAAAGGAGAAAGGAAGG - Intergenic
910868093 1:91806137-91806159 TTAGTGAAAAGGATGGAGGAGGG - Intronic
911201015 1:95043759-95043781 GAAAGGAGAAGGAGCGAGGAGGG + Intronic
911313583 1:96328048-96328070 GTAGAGAGAAGGAGAGATGAGGG + Intergenic
911510820 1:98805966-98805988 TAAGGGTGAAGGAGCAAGGCAGG + Intergenic
912631803 1:111252820-111252842 TTAGGAAGAAAGAGGGTGGAAGG - Intergenic
912663873 1:111561505-111561527 ATTGGGGGAAGGAGGGAGGAAGG + Intronic
912757069 1:112333388-112333410 TTGGGGAGAAGGAAAGTGGAAGG - Intergenic
913073774 1:115324028-115324050 TAAGGGAGATGAAGCGAGCAGGG - Intronic
913301872 1:117379633-117379655 CTAGGGGGAAGCAGGGAGGAGGG - Intronic
915347212 1:155203597-155203619 TTGGTGAGAAGGAGGAAGGAAGG + Intronic
915627120 1:157121095-157121117 TGAGGGTGGGGGAGCGAGGACGG + Intergenic
915721824 1:157991606-157991628 TTAGGGAGAGGGAGAGAGGGAGG - Intergenic
916146975 1:161748881-161748903 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
916149331 1:161771125-161771147 GAAGAGAGAAGGAGAGAGGAGGG - Intronic
916197500 1:162238198-162238220 TGGGGGAGAAGGAGGGAGAATGG + Intronic
916460961 1:165023788-165023810 GTAGGGAGAGAGAGAGAGGAAGG + Intergenic
917599087 1:176557305-176557327 TTAGACATAGGGAGCGAGGATGG + Intronic
917605585 1:176625285-176625307 TCAGCTAGAAGGAGTGAGGAAGG + Intronic
919468924 1:197954730-197954752 TTAGGGGGAAGGAGTGGGGGTGG - Intergenic
919887367 1:201944677-201944699 AGAGGGAGAAGGAGGGAGGAAGG - Intronic
919942955 1:202300963-202300985 TCAGGGAGGAGGACAGAGGATGG + Intronic
920108390 1:203570345-203570367 TTAGGGAGCAGGAGACAGGCAGG - Intergenic
920363000 1:205432184-205432206 GAAGGGAAAAGGAGGGAGGAGGG + Intronic
920662762 1:207931555-207931577 TTGGGGAGAGGGAGAGAGAAGGG + Intergenic
920844925 1:209585724-209585746 TGGGGGAGAGGGAGCGAGGGAGG - Intronic
922020856 1:221703113-221703135 TGAAGGAAAAGGAGAGAGGAAGG + Intronic
922799550 1:228358947-228358969 TTTGGGAGATGGAGCCAGGCAGG + Intronic
923086879 1:230708953-230708975 TTTGGGGCAAGGAACGAGGATGG - Intronic
923328531 1:232901485-232901507 TTAGGGAGATGCACCGAGAAAGG + Intergenic
923519358 1:234724132-234724154 GGAGGGAGAGGGAGGGAGGAAGG + Intergenic
923628599 1:235634604-235634626 TTAGGAACAAGGAGCCAGGCTGG - Intronic
924519500 1:244794088-244794110 TTGGGAAGAAGGAGGGAAGAGGG - Intergenic
1062829115 10:593582-593604 TTGGGGGGAAGTACCGAGGAGGG - Intronic
1063341315 10:5266408-5266430 TTAGGTAGAAAGAGCAGGGAGGG + Intergenic
1063932532 10:11043591-11043613 TTAGTGAGATGGAGAAAGGAAGG - Intronic
1064134867 10:12741852-12741874 TTTGGGACAAGGAGGGAGGATGG + Intronic
1064229727 10:13519518-13519540 TCTGGGAGAAGGAGAGAGAATGG + Intronic
1064338649 10:14467236-14467258 TAGGGGAGAAGGAGCGAGCCTGG + Intergenic
1064504016 10:16009857-16009879 TTAGGAAGAAGGAGAGAGGATGG + Intergenic
1065156009 10:22870856-22870878 GGAGGGTGAAGGAGGGAGGATGG - Intergenic
1066227154 10:33394390-33394412 TAAGAGAGAAGGAACAAGGAGGG + Intergenic
1066371537 10:34822017-34822039 GGAGGGAGAGGGAGGGAGGAAGG + Intergenic
1067222194 10:44352413-44352435 TTTGGGAGAAAGACTGAGGAGGG + Intergenic
1067251850 10:44593310-44593332 AGAGGGAGAAAGAGAGAGGAAGG + Intergenic
1068189717 10:53635483-53635505 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
1068385694 10:56324313-56324335 CTAGGGAGAAAGAGTGAGTACGG - Intergenic
1069230352 10:66001266-66001288 CCAGGGAGAAGGAGAGAGGGAGG - Intronic
1069311544 10:67044087-67044109 TTGGGGGGAAAGAGGGAGGAGGG - Intronic
1069637650 10:69935520-69935542 GGAGGGAAAAGGAGCGGGGAGGG - Intronic
1069824713 10:71247912-71247934 TCAGGGAAAAGGAGAAAGGATGG + Intronic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070426986 10:76298409-76298431 TAAAGGACAAGGAGAGAGGATGG - Intronic
1070553704 10:77512246-77512268 TTAGGGAAAAGGAGTCAGGCTGG - Intronic
1070811674 10:79301227-79301249 GTAGGGAGGAGGGGCCAGGAGGG - Intronic
1070834583 10:79440295-79440317 TTTAGGAGAAGGAGAGAAGATGG - Intronic
1071854977 10:89614914-89614936 TTAGGGAGAGGAAGGGAGGAAGG + Intronic
1071876247 10:89846366-89846388 GAAGGGAGAAGGAGGGAGGAAGG + Intergenic
1072306986 10:94117116-94117138 TGAGAGTGAAGGAGAGAGGATGG - Intronic
1072587036 10:96792005-96792027 AGAGGGAGAGGGAGGGAGGAAGG - Intergenic
1072943599 10:99789412-99789434 TTATTGAAAAGGAGCGGGGAGGG + Intronic
1073071711 10:100798578-100798600 ATAGGAAAAAGGAGAGAGGAGGG - Intronic
1073688456 10:105781533-105781555 GTAGGGAGGAGGAGCCAAGATGG - Intergenic
1073759827 10:106617280-106617302 GGAGGCAGAAGGAGGGAGGAAGG - Intronic
1073796766 10:106996984-106997006 TTAGGGAAAAGGAAAGAGGTAGG + Intronic
1074043810 10:109818439-109818461 TTAAGGAGGAGGAGCCAAGATGG - Intergenic
1074436409 10:113438114-113438136 TTAGGCTCAAGGAGGGAGGAAGG - Intergenic
1074753333 10:116607506-116607528 GCAGGGAGTAGGAGGGAGGAAGG + Intronic
1075300849 10:121322898-121322920 TTAGGGAGAAGTAGGAAGGCTGG - Intergenic
1075420988 10:122300019-122300041 TAAGGGAGAAGGAGCCTGGCAGG - Intronic
1075426637 10:122346983-122347005 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
1075439939 10:122471911-122471933 TTAGGGAGAAGTAGGGAGAAGGG - Intronic
1075536284 10:123274973-123274995 TTAGGGAGGAGGTGGGAGGGTGG - Intergenic
1075619408 10:123914817-123914839 TCAGGGAGAAAGAGAGAGCATGG - Intronic
1075656242 10:124163005-124163027 GAAGGGGGAAGGAGGGAGGAAGG + Intergenic
1076252402 10:128994790-128994812 TGAGGGAGAAAGAGGGAGGGAGG + Intergenic
1076384757 10:130048139-130048161 TCAGGGAGGAGGAGGCAGGAAGG + Intergenic
1076418770 10:130312959-130312981 CTAGGGAGAAGCAGAAAGGAGGG + Intergenic
1076489708 10:130850068-130850090 TGAAGGAGAAGGAGAGGGGAAGG - Intergenic
1076611105 10:131726424-131726446 TTAGAGAGAGGGAGGGAGGGAGG - Intergenic
1076916605 10:133425586-133425608 TCAGGCAGAAGGAGCTTGGAAGG + Intergenic
1076936709 10:133570381-133570403 TCAGGCAGAAGGAGCTTGGAAGG + Intergenic
1076989863 11:267373-267395 GGAGGGGGGAGGAGCGAGGAGGG + Intergenic
1076989870 11:267390-267412 GGAGGGGGGAGGAGCGAGGAGGG + Intergenic
1076989877 11:267407-267429 GGAGGGGGGAGGAGCGAGGAGGG + Intergenic
1076989931 11:267532-267554 GGAGGGGGGAGGAGCGAGGAGGG + Intergenic
1077030113 11:461709-461731 AAAGGGAGAAGGAGCGAGCTGGG - Intronic
1077070077 11:665745-665767 GCAGGGAGATGGAGCCAGGAAGG + Intronic
1077323948 11:1955492-1955514 AGAGGGAGGAGGAGTGAGGATGG - Intronic
1077463541 11:2722786-2722808 GTAGAGGGAAGGAGGGAGGAAGG - Intronic
1078132753 11:8626157-8626179 TTAGGGAAAAGGAGGGAGACTGG + Intronic
1078196267 11:9139439-9139461 ATAGGGAGAGGGAGCGAGGCTGG - Exonic
1078356013 11:10631899-10631921 TTAAAGAGCAGGAGAGAGGAAGG + Intronic
1078543619 11:12230524-12230546 TTAGGGAGGGGCAGGGAGGAAGG - Intronic
1078699835 11:13669263-13669285 TGAGGGAGAAGGCGCGGGGCCGG + Intronic
1078914297 11:15763810-15763832 AGAGAGAGAAGGAGGGAGGAAGG + Intergenic
1078919998 11:15821309-15821331 TTAGCATGAAGGAGTGAGGATGG + Intergenic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1079126391 11:17721000-17721022 TGAAGGAGGAGGAGCGAGCAGGG - Intronic
1079128629 11:17735267-17735289 GCGGGGAGAAGGAACGAGGAGGG + Exonic
1079196316 11:18330669-18330691 TTAGGGAAAAGGAGTCAGGCTGG - Intronic
1080254376 11:30272549-30272571 GAAGGGAGAGGGAGAGAGGAAGG + Intergenic
1080387038 11:31816503-31816525 TGAGGGAGGAGGCCCGAGGATGG + Intronic
1080952386 11:37049883-37049905 ATAGGCAGAAGGAGAGAAGAAGG - Intergenic
1081103836 11:39039325-39039347 TTGGGGAGAAGGAGTCAGAAGGG + Intergenic
1081542839 11:44048739-44048761 TTAGGGAGAGGGAGGGATGTGGG - Intronic
1083129119 11:60606750-60606772 GTAGAGAGAAGGGGCTAGGAGGG + Intergenic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084614212 11:70225017-70225039 TTTGGTAGAAGGAGTGAGGTAGG - Intergenic
1084638210 11:70407525-70407547 TGAGTGAGAAGGAGCAAAGATGG + Exonic
1084796273 11:71506585-71506607 TCAGGGAAAAGGAGCCAGGGTGG + Intronic
1084911482 11:72393060-72393082 TTAGGGGCAAGGCTCGAGGAAGG + Intronic
1084919557 11:72458128-72458150 TGAGGGAGAGGGAGGAAGGAGGG + Intergenic
1084942596 11:72620866-72620888 TGGGGGAGAGGGAGAGAGGAGGG + Intronic
1085507660 11:77069377-77069399 TTTGGGAGAAGAAGGGTGGAAGG + Intronic
1085699019 11:78729747-78729769 AAAGGCAGAAGGAGAGAGGAGGG + Intronic
1085989540 11:81825271-81825293 TGAGGGGGAAGGAGGGAGGAAGG + Intergenic
1086220506 11:84437603-84437625 TGAGGGAGAGGGTGGGAGGAGGG + Intronic
1086559637 11:88153400-88153422 TTTGGTTGAAGGAGTGAGGAGGG - Intronic
1086663210 11:89447765-89447787 TTAGGGAGAGGGAGAGTGAAAGG - Intronic
1086805021 11:91230307-91230329 TTAGGGAGAAGGAGATATTATGG - Intergenic
1086957690 11:92950523-92950545 TGAGAGAGAGGGAGGGAGGAAGG - Intergenic
1087067824 11:94044086-94044108 TTATGGAGCTGGAGCTAGGATGG + Intronic
1087176089 11:95097192-95097214 TTAAGGAGAAAAAGCAAGGAAGG + Intronic
1088173027 11:107018539-107018561 AAAGGGAGAAGGAGGGAGGCAGG - Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1089128565 11:116194349-116194371 GAAGGGAGGAGGAGAGAGGAAGG - Intergenic
1089187075 11:116625389-116625411 TTAGGGAGAAGGAGGGAAGAAGG - Intergenic
1090608963 11:128453071-128453093 AGAGAGAGAAGGAGGGAGGAAGG + Intergenic
1090872183 11:130758286-130758308 TAAGGGTGAAGGACCGAGGCAGG + Intergenic
1091242174 11:134060610-134060632 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
1202806934 11_KI270721v1_random:10687-10709 AGAGGGAGGAGGAGTGAGGATGG - Intergenic
1091774221 12:3173839-3173861 TTAAGGAGGAGGAGGGAGGGAGG - Intronic
1091824953 12:3505210-3505232 TTGGGGAGGAGGAGCCAAGATGG - Intronic
1091842019 12:3628137-3628159 TGGGGGAGAGGGAGGGAGGAAGG - Intronic
1091849807 12:3686568-3686590 AGAGGGAGAGGGAGAGAGGATGG - Intronic
1092084542 12:5744965-5744987 TTAGGGAGAATGAAAGAGCAAGG + Intronic
1092203759 12:6603361-6603383 TTGGGAAGAGGGAGAGAGGAGGG - Intronic
1092624996 12:10317328-10317350 TTAGGGAAAAGGAGTTAGGCTGG + Intergenic
1092938541 12:13386314-13386336 CTGGGGAGAAGGAACAAGGAAGG - Intronic
1093087242 12:14879762-14879784 TTAGGGAGAGGGAACCAAGATGG + Intronic
1094023593 12:25940297-25940319 TGAGAGAGAAGGAGAGAGAATGG - Intergenic
1094577983 12:31705625-31705647 TTAGGGAAAAGGAGTCAGGCTGG + Intronic
1094782871 12:33813080-33813102 TTAGCGAGAAGGAAGAAGGAAGG + Intergenic
1095139900 12:38648896-38648918 TTAGGGGGAAGGATAAAGGAAGG - Intronic
1096011114 12:48216146-48216168 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
1096144654 12:49269779-49269801 GGAGGGACAAGGAGCGGGGAGGG - Intronic
1096636091 12:52960562-52960584 TTGGGGATCAGCAGCGAGGATGG + Intergenic
1096638271 12:52975005-52975027 TTACAGAGAAGGAGCCAGGCTGG + Intergenic
1096676271 12:53227688-53227710 CTAGGGAGAAAGAGAGAGAAAGG + Intronic
1096977173 12:55706199-55706221 AGATGGAGAAGGAGGGAGGAAGG + Intronic
1097207311 12:57333721-57333743 CTAGAGGGAAGGAGGGAGGAAGG + Intronic
1098460785 12:70730970-70730992 TGAGGAGGAAGGAGAGAGGAAGG + Intronic
1098714805 12:73816137-73816159 TTAGGGAGAAGGATCTATGAGGG + Intergenic
1099064933 12:77963993-77964015 GGAGGGAGGAGGAGGGAGGAGGG - Intronic
1099351555 12:81576286-81576308 TTAGCCAGATGGAGTGAGGAAGG + Intronic
1099506728 12:83486794-83486816 TTAGGGAGATGAAGAGAGGTTGG - Intergenic
1100864347 12:98840478-98840500 ATAGTGAGAAAGAGCGAGGGAGG + Intronic
1100940057 12:99716023-99716045 TAAGGGTGAAGGACCGAGGCAGG - Intronic
1101744422 12:107527734-107527756 TTATGGAGAAGGAGAGATGAAGG - Intronic
1101925637 12:108969283-108969305 GTAGGGAGAGAGAGTGAGGAAGG - Intronic
1102522442 12:113486977-113486999 TGAGAGAGAAGGAGCCAGCAGGG - Intergenic
1102631901 12:114288418-114288440 TTGGGGAGAGGGAGAGAGGAGGG + Intergenic
1102781265 12:115567086-115567108 TTGGGGAGAAAGAGTGAGGTGGG - Intergenic
1103562841 12:121801025-121801047 TTTGGGAGGAGGAGCGAGCGCGG + Intronic
1103936743 12:124481154-124481176 GGAGGAAGAAGGAGGGAGGAAGG + Intronic
1104004699 12:124883831-124883853 TGGGGAAGAAGGAGCGAGCAAGG - Intergenic
1105538009 13:21287809-21287831 ATAAGGAGGAGCAGCGAGGACGG - Intergenic
1105886859 13:24649834-24649856 GGAGGGAGAAGGGGGGAGGAGGG - Intergenic
1106072411 13:26425107-26425129 TTAAGGTGATGGAGGGAGGATGG + Intergenic
1106758326 13:32844234-32844256 TGAGGGAGCAGGAGTGAGAAGGG - Intergenic
1108162692 13:47658463-47658485 ACAGGGAGAAGGAGAGAGAAAGG - Intergenic
1109405829 13:61898837-61898859 GGAGGGAGGAGGAGGGAGGAAGG - Intergenic
1110119853 13:71866851-71866873 GGGGGGAGAAGGAGCGAGGGGGG + Intronic
1110749765 13:79099237-79099259 TTAGGCAGAAGGAGATAGAAAGG - Intergenic
1110827742 13:79992168-79992190 AGAGGGAGAAGGAGCCAGGCAGG - Intergenic
1110828031 13:79995908-79995930 TAAGGGAGTAGGAGTGAAGATGG + Intergenic
1111027136 13:82542796-82542818 GGAGGGAGAAGGAGAGAGGGAGG + Intergenic
1111105524 13:83641172-83641194 TAAGGGAAAAGGAACGAGTAGGG - Intergenic
1111278667 13:85988777-85988799 TTATGGGGAAGGAGTGGGGAAGG + Intergenic
1112015186 13:95325604-95325626 GAAGGGAGAAGGAAGGAGGAAGG + Intergenic
1112324922 13:98437762-98437784 TAAGGGAAAAGGAGCCAGGCTGG - Exonic
1112475328 13:99726715-99726737 TTAGGGATAAGGGGCGGGGGAGG - Intronic
1114423230 14:22602049-22602071 TGGGGGAGAAGGAAGGAGGAAGG - Intronic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1115027809 14:28764498-28764520 TAAGGGAGAAGGAGGGAGGAGGG + Intergenic
1115275648 14:31606015-31606037 GGAGGGAGAAGGAGTGAGGGAGG - Intronic
1117157461 14:52954950-52954972 TTTGAAAGAAGGAGAGAGGATGG + Intergenic
1117311179 14:54524781-54524803 TTATAGGGAAGGAGCGGGGAGGG - Intronic
1118564995 14:67129823-67129845 GAAGGGAGAGGGAGGGAGGAAGG + Intronic
1118589716 14:67392428-67392450 CTAGGGGGAAGGAGGGAGCAAGG + Intronic
1120305494 14:82764449-82764471 GTAGGGAGAAGGAAAGAGTAAGG - Intergenic
1120539705 14:85737424-85737446 TAAGGGAGAAGAAGGGAGAATGG + Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120894071 14:89514159-89514181 TGAGGGAGAAGGAGGATGGAAGG + Intronic
1121275285 14:92663331-92663353 GTAGGGAGGAGGAGCAAGAAAGG + Intronic
1121552894 14:94815561-94815583 ATAAGGAAAAGGAGCGAGGCCGG - Intergenic
1121561886 14:94881995-94882017 TTAGGGAGTGGGAGCGTGGTTGG - Intergenic
1121599954 14:95195954-95195976 CTTGGGAGAAGGAGGGAGCAGGG - Intronic
1121776426 14:96593723-96593745 TTTGGGAGTAGGGGCGGGGAAGG + Intergenic
1122040159 14:98981796-98981818 TCAGGGAGGGGGAGGGAGGAGGG + Intergenic
1122579457 14:102762403-102762425 GTAGGGAGAATAAGGGAGGATGG + Intergenic
1122635582 14:103128153-103128175 TAGGGGAGAAGGTGAGAGGAAGG + Intronic
1122896689 14:104761089-104761111 CCAGGCAGAAGGAGCGAGGGGGG - Intronic
1123170289 14:106366839-106366861 AGAGAGAGAAGGAGGGAGGAAGG + Intergenic
1123201606 14:106671366-106671388 TGAGAGAGAAGGAGGGAAGAAGG + Intergenic
1124497293 15:30194119-30194141 TTTGCTAGAAGGAGGGAGGATGG + Intergenic
1124746281 15:32344528-32344550 TTTGCTAGAAGGAGGGAGGATGG - Intergenic
1125147702 15:36491424-36491446 TGAGGGAGAGGGAGAGAGAAGGG + Intergenic
1125370666 15:38972801-38972823 TGTGGGAGAAGGAGAAAGGAAGG + Intergenic
1126551084 15:49930238-49930260 TTAGGGATGAAGAGGGAGGATGG + Intronic
1126947243 15:53835348-53835370 CTAGGAAGATGGAGAGAGGAAGG + Intergenic
1127197835 15:56609100-56609122 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
1127496689 15:59519487-59519509 AAAGAGAGAAGGAGGGAGGAAGG - Intronic
1127633547 15:60848373-60848395 TAAGGGAAAAAGAGGGAGGAAGG + Intronic
1128120062 15:65139154-65139176 TTAGGGAAAAGGAGTGGGGCTGG + Intergenic
1128258679 15:66216742-66216764 TTAGGGAGAAAGGAGGAGGAGGG + Intronic
1128458816 15:67850673-67850695 AGAGAGAGAAGGAACGAGGAGGG + Intergenic
1128511313 15:68315621-68315643 TTGGGGAGAAGGAGCAGGCACGG + Intronic
1128789053 15:70419309-70419331 TTTGTGAGAAGCAGAGAGGAGGG + Intergenic
1129182380 15:73885415-73885437 TGAGGAAGAAGCAGCGAGGAGGG - Intronic
1129330367 15:74824035-74824057 TGAGGGCGAGGGAACGAGGATGG - Intronic
1129851774 15:78797707-78797729 TAGGTGAGATGGAGCGAGGAAGG + Intronic
1129926148 15:79365968-79365990 TTAGGGAAAAGGAGTCAGGCTGG + Intronic
1130397180 15:83512781-83512803 ATAGGGAGAGGGAGGGAGGGAGG - Intronic
1131166394 15:90145086-90145108 GAAGGGTGAAGGAGGGAGGAGGG - Intergenic
1132291856 15:100709412-100709434 TATTGGAGAAGGAGTGAGGAAGG + Intergenic
1132322776 15:100938560-100938582 TGTGGGGGAAGGAGGGAGGATGG - Intronic
1132535044 16:474627-474649 AGTGGGAGAAGGAGGGAGGACGG - Intronic
1132606094 16:794357-794379 GTGGGGAGCAGGAGCCAGGAGGG + Intronic
1133392630 16:5422345-5422367 GGAGGGAGAAGGAGGGAGCAGGG + Intergenic
1133640616 16:7713540-7713562 TTTGGGAAAATGAGTGAGGAAGG - Intergenic
1133760816 16:8797169-8797191 AGAAGGAGAAGGAGCGAGGCAGG + Intronic
1134823969 16:17269772-17269794 AAAGGGAGAAGGAGAGAGGTGGG - Intronic
1135010870 16:18877442-18877464 GTGGGGAGAGGGAACGAGGAAGG + Intronic
1135213718 16:20546230-20546252 TTAGGGGGAAGGAGAGAGTGAGG - Intronic
1135317757 16:21465027-21465049 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135370652 16:21896826-21896848 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135441134 16:22473893-22473915 GTGGGGAGAGGGAACGAGGAAGG - Intergenic
1135920390 16:26644087-26644109 AAAGGGAGAAGGAGGGAGGAAGG - Intergenic
1135939592 16:26809746-26809768 CAAGGGAGAAGGAGGAAGGAAGG + Intergenic
1136327970 16:29546477-29546499 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1136524734 16:30821779-30821801 TTAGGTAGAAAGAGCAGGGAGGG - Intergenic
1136694874 16:32069592-32069614 TTATGGAGAGAGAGAGAGGAAGG + Intergenic
1137688482 16:50403164-50403186 ATGGTGAGAAGGAGGGAGGAAGG + Intergenic
1137776677 16:51060746-51060768 GAAGGGAGAAGGAGGGAGGGAGG + Intergenic
1139180727 16:64745303-64745325 ATAGGAAGATGGAGGGAGGAAGG - Intergenic
1139424988 16:66873856-66873878 GGAGGGAGGAGGAGGGAGGAGGG - Intergenic
1139494926 16:67309427-67309449 TGAAGGAGAGGGAGAGAGGATGG + Intronic
1139618278 16:68114380-68114402 TTAGGCAGGAGGAGCCAAGATGG - Intronic
1140045950 16:71440874-71440896 TGAGGGAGGAGGTGGGAGGAGGG - Intergenic
1140604445 16:76517820-76517842 TTAGGGAGATGGAGCGATCGAGG - Intronic
1140772442 16:78217222-78217244 TTAGGAAGAATCAGGGAGGAAGG - Intronic
1141320636 16:83005330-83005352 ACAGGGAGAAAGAGTGAGGAGGG - Intronic
1141789542 16:86225210-86225232 TTAAGGAGAAAGAGAGAGGCAGG - Intergenic
1203097630 16_KI270728v1_random:1274514-1274536 TTATGGAGAGAGAGAGAGGAAGG + Intergenic
1142618889 17:1153225-1153247 CTAGGCAGAAGGACCAAGGAAGG + Intronic
1143278345 17:5731284-5731306 GCAGGGGGAAGGAGGGAGGAGGG - Intergenic
1143799732 17:9368667-9368689 TTAAGGAAAAGGAGGGAGGGAGG - Intronic
1143919557 17:10320080-10320102 CAAGGGGGAAGGAGTGAGGAGGG + Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144365623 17:14541775-14541797 AGAGGGAGAAGGAGTGAGGAAGG - Intergenic
1144480482 17:15624957-15624979 CTAGGGAGAATGAGAGAGGACGG + Intronic
1144759839 17:17701054-17701076 TCAGGGAGGATGAGCGAGGAGGG - Intronic
1144917828 17:18738788-18738810 CTAGGGAGAATGAGAGAGGACGG - Intergenic
1145065799 17:19760336-19760358 TAAGGGAGAGGGAGAGAGGAGGG - Intergenic
1145280362 17:21463448-21463470 TGAGGGAGAAAAAGGGAGGAGGG - Intergenic
1145397526 17:22507031-22507053 TGAGGGAGAAAAAGGGAGGAGGG + Intergenic
1145752495 17:27365368-27365390 TGAGCTAGAAGGAGCAAGGAAGG + Intergenic
1145792988 17:27639326-27639348 GGAGGGAGAGGGAGAGAGGAAGG - Intronic
1146268392 17:31468227-31468249 GAAGGGAGACGAAGCGAGGAAGG - Intronic
1147979572 17:44266242-44266264 TTTGGGAGAAGCAGAGAGGGAGG - Intronic
1148026787 17:44594192-44594214 GGAGGGAGAGAGAGCGAGGAAGG + Intergenic
1148067519 17:44883245-44883267 TTAGGGATAAGGAGAGAAAAAGG + Intronic
1148236751 17:45974279-45974301 GCAGGGAGGAGGAGTGAGGAGGG - Intronic
1148511006 17:48169781-48169803 TAATGGAGAAGGAGCAGGGAGGG + Intronic
1148545551 17:48516062-48516084 AGAGAGAGAAGGAGGGAGGAAGG + Intergenic
1149059928 17:52409847-52409869 TTTGGGGGAAGGAGCCAAGATGG - Intergenic
1149267308 17:54941013-54941035 CTAGGGAAAAGGAGAGAGGGAGG - Intronic
1149394892 17:56230343-56230365 TTTTGGGGAAGGAGAGAGGAAGG + Intronic
1149637281 17:58181027-58181049 GGAGGGAAAAGGAGTGAGGAGGG - Intergenic
1149888390 17:60363855-60363877 TTTGGGAGAAGGAAGGAGGAAGG + Intronic
1150004928 17:61463563-61463585 GCAGGGAGAAGGAGAGGGGAAGG + Intronic
1150039947 17:61850028-61850050 TTAGAGAGAAGCAAAGAGGAAGG - Intronic
1150351076 17:64444935-64444957 TTATGGAGAAGGAGGAAAGATGG - Intergenic
1151427776 17:74042290-74042312 GAAGGTAGAAGGAGCAAGGAGGG + Intergenic
1151467644 17:74297891-74297913 TTCGGGAGTGGGAGCCAGGATGG + Intronic
1151491443 17:74434024-74434046 GGAGAGAGAAGGAGGGAGGAGGG + Intronic
1152043052 17:77917440-77917462 GGAGGGAGGAGGAGGGAGGAGGG + Intergenic
1152085005 17:78212641-78212663 TTGGGGAGAGGGAGAGAGAAAGG + Intergenic
1152598449 17:81249492-81249514 GGAGGGAGAAGGAGGGAGGAGGG + Intronic
1152750740 17:82061355-82061377 TGTGGGAGGAGGAGCGGGGAAGG + Intronic
1153246166 18:3074392-3074414 ACAGGGAGAAGGAGCAAGAAGGG - Intronic
1153383607 18:4467353-4467375 GCAGGGAGAGGGAGGGAGGAGGG - Intergenic
1153474760 18:5487339-5487361 GTAGGGAGGAGGAGTGATGAAGG + Intronic
1153893842 18:9541597-9541619 GGAGGGAGAGGGAGCCAGGAGGG - Intergenic
1155345705 18:24854846-24854868 TGAGGGAAAAGGAGTGAGAAGGG - Intergenic
1156013131 18:32516762-32516784 TTAGGGAAAAGGAGTTAGGCTGG - Intergenic
1156855297 18:41775011-41775033 GTAGGGAGGAGGAGCCAAGATGG + Intergenic
1156909306 18:42391899-42391921 AGAGAGAGAAGGAGCGAGGGAGG - Intergenic
1157280762 18:46345040-46345062 TTGGCCAGAAGGAGCGAGGCAGG - Intronic
1157310179 18:46546836-46546858 TTAGGGAGAGGCAGAGGGGAGGG + Intronic
1157323333 18:46650697-46650719 TGAGGGAGAATGGGGGAGGAAGG + Intronic
1157594875 18:48858405-48858427 TTAGGGAGAAGGAGAAAGCCTGG + Intronic
1158081172 18:53592511-53592533 TTAGGAAGAAGAAGGAAGGAAGG - Intergenic
1158164998 18:54530349-54530371 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
1158374613 18:56848739-56848761 TGAGAGAGAAAGAGCGAGCAAGG - Intronic
1159653147 18:71000709-71000731 AGAGGGAGAGGGAGGGAGGATGG + Intergenic
1159969257 18:74628817-74628839 TGAAGGACAAGGAGGGAGGATGG - Intronic
1160872085 19:1282231-1282253 TGAAGGGGAAGGAGGGAGGAGGG + Intergenic
1160985266 19:1835762-1835784 TTGGGGTGAAGCAGGGAGGAAGG - Intronic
1161056466 19:2193108-2193130 TAAGGGAGAAGGAGGGAACAGGG - Intronic
1161403952 19:4081646-4081668 GCAGGGAGGAGGAGGGAGGAGGG - Intergenic
1161544707 19:4873290-4873312 TGAGCGAGAGGGAGGGAGGAGGG - Intergenic
1162444399 19:10713277-10713299 ATTGGGAGAGGGAGGGAGGAAGG + Exonic
1162937052 19:13986542-13986564 TCAGGGAGGAGAAGCCAGGAGGG + Intronic
1162968548 19:14167157-14167179 TGGGGAAGCAGGAGCGAGGAAGG - Intronic
1163081277 19:14944499-14944521 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
1163092675 19:15031806-15031828 GCAGGGAGAAGGAAGGAGGAAGG + Intergenic
1163112555 19:15170301-15170323 TCAGGGACAGGGAGCGAGCAGGG + Intronic
1164441885 19:28285085-28285107 TGAAGGAGAAGGAGTGTGGAAGG + Intergenic
1164464712 19:28477792-28477814 TTAGGGAGAAGGTGTGAACAGGG - Intergenic
1164680427 19:30130827-30130849 AAAGGGAGAAGGAAGGAGGAGGG - Intergenic
1165876184 19:39008653-39008675 CCAGGGAGGAGGAGGGAGGATGG - Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166254673 19:41594670-41594692 TTAGGGAGCAGGAAGGAGCAAGG + Intronic
1166881111 19:45930686-45930708 GAAGGGGGAAGGAGGGAGGAAGG - Intergenic
1166975817 19:46604443-46604465 TTAGGGAGGGGGAAAGAGGAAGG - Intronic
1167254406 19:48418655-48418677 CGAGGGAGAAGGAGGGAGGAAGG + Intronic
1167529195 19:50004401-50004423 GCAGGGAGAAAGAGCGAGAAGGG - Intronic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167704490 19:51071387-51071409 TTAGGTAGAAAGAGCAGGGAGGG - Intergenic
1168645280 19:58055499-58055521 TGAGAGAGAAGGTGCCAGGAGGG - Intergenic
925055730 2:855639-855661 TTAGGGAGATGGAGAGTGGTTGG - Intergenic
925889954 2:8425578-8425600 TTAGGAGGAAGGAGACAGGATGG + Intergenic
926407503 2:12570536-12570558 TAAGGGTGAAGGACCGAGGCAGG - Intergenic
927320658 2:21741741-21741763 TTAGTGGGAAGGAGAGATGATGG + Intergenic
928950507 2:36809159-36809181 GTAGGGAGAAGGAACAAGGATGG + Intronic
929460084 2:42097044-42097066 TTAGGGAGGAGGAGCCAGGGTGG - Intergenic
929484576 2:42342286-42342308 CTAGGGAGAGGGAGAGAGCAGGG - Intronic
930347705 2:50205940-50205962 CTTGGGAGAAGGAGAGAGAAGGG + Intronic
930589595 2:53311764-53311786 TGAGAGAGAAGGAGGGAGGGAGG - Intergenic
930991358 2:57659745-57659767 TGAGGGAGAGGGTGGGAGGAGGG - Intergenic
932117011 2:69060551-69060573 TAAGGTAGAAGGAGAGAGTATGG + Intronic
932265490 2:70364097-70364119 TTCGGCAGATGGAGTGAGGAAGG + Intergenic
933355325 2:81202436-81202458 TTAGGGAGAAGGAGGAAAAAAGG + Intergenic
934055328 2:88246827-88246849 GGAGGAAGAGGGAGCGAGGAGGG - Intergenic
935725965 2:106024294-106024316 TTGGGGAGTAGAAGCGGGGAGGG + Intergenic
936738943 2:115480405-115480427 CTAGGAAGTAGGAACGAGGAGGG - Intronic
936929944 2:117778175-117778197 TTTGGGAGGAGGAGCCAAGATGG + Intergenic
936971044 2:118176585-118176607 GTGGGGAGAAGGAGCAAGGAGGG - Intergenic
937261309 2:120588183-120588205 TCAGGGAGAATGAGTAAGGATGG - Intergenic
937658813 2:124407866-124407888 TTCGGGAGGAGGAGCCAAGATGG + Intronic
938196827 2:129335868-129335890 TTAGGGAGAAGGGCCTGGGAGGG - Intergenic
939333918 2:140800248-140800270 TAGGGGAGGAGGAGCGGGGAGGG + Intronic
940552796 2:155182992-155183014 TCAGAGGGAAGGAGGGAGGAGGG + Intergenic
941396521 2:164980768-164980790 AGAGAGAGAGGGAGCGAGGAAGG - Intergenic
941801615 2:169665881-169665903 TTAGGGAAAAGGAGTCAGGCTGG - Intronic
942770432 2:179511443-179511465 ATAGGCAGAAAGACCGAGGAGGG + Intronic
943545682 2:189273895-189273917 TTAGGGAGAAGGAGTAAGTTTGG + Intergenic
943868095 2:192955320-192955342 TGTGGGAGAATGAGGGAGGAAGG - Intergenic
943886175 2:193218430-193218452 GTAGGGAGGAGGAGCCAAGATGG - Intergenic
944150412 2:196552642-196552664 ATAGGGAGCGGGAGAGAGGAAGG - Intronic
944529046 2:200649687-200649709 TCTGGGAGGAGGAGCCAGGAAGG - Intronic
944605197 2:201346383-201346405 TCAGGAAGCAGGGGCGAGGAGGG + Intronic
944980163 2:205108505-205108527 TTAGAGAGAGGGAGGGAGGGAGG - Intronic
945224464 2:207519397-207519419 TTATGGGGAAAGAGGGAGGAAGG - Intergenic
946872000 2:224092659-224092681 TAAGGGTGAAGGACCAAGGAAGG + Intergenic
947127885 2:226890972-226890994 TTAGTGAGATAGAGCCAGGAGGG - Intronic
947267876 2:228302763-228302785 TTAGGGAGGGAGAGAGAGGAGGG + Intergenic
947892802 2:233640873-233640895 TTAGGGAAAAAGAGCTAGGCTGG + Intronic
948091848 2:235301935-235301957 GGAGGGAGCAGGAGGGAGGAGGG - Intergenic
948091948 2:235302218-235302240 AGAGGGAGGAGGAGGGAGGAGGG - Intergenic
948665167 2:239530017-239530039 TGAGGGTGTAGGAGGGAGGAGGG - Intergenic
948720050 2:239893835-239893857 GCAGGGAGAAGGAGTGAGGCTGG - Intronic
948720130 2:239894178-239894200 GCAGGGAGAAGGAGTGAGGCTGG - Intronic
948720139 2:239894218-239894240 GCAGGGAGAAGGAGTGAGGCTGG - Intronic
948952530 2:241263460-241263482 TTATGGAGAAGAACTGAGGAGGG + Intronic
1169431825 20:5543058-5543080 TTTGGTAGAAGGAAGGAGGAAGG + Intergenic
1169495754 20:6113365-6113387 AAAGGGAGAGGGAGCAAGGAAGG - Intronic
1169744868 20:8933429-8933451 ATAGAGAGCAGGAGGGAGGAGGG + Intronic
1170370205 20:15639986-15640008 TGAGAGAGAAGGAGAGAGAAAGG + Intronic
1170771856 20:19339833-19339855 GTAGAGAGAAGAAGGGAGGAAGG + Intronic
1171011817 20:21513157-21513179 TTAAGGAGAAAGAGGGAGAAGGG - Intronic
1171486389 20:25489456-25489478 GTAAGGAGAAGGAGGGGGGATGG - Intronic
1171907198 20:30908814-30908836 TAGGGGAGAAGGAGAGAGAAAGG + Intergenic
1172181748 20:33007947-33007969 TCAGGGAGAGGGAGCCAGGCAGG - Intronic
1173300052 20:41794474-41794496 TTGGGGAGAAGGAAGGAGGGAGG - Intergenic
1173427489 20:42955802-42955824 TGAGGGAGAAGGAGGGAGGGAGG + Intronic
1173427498 20:42955828-42955850 TGAGGGAGAAGGAGGGAGGGAGG + Intronic
1173427505 20:42955846-42955868 GGAGGGAGAAGGAGGGAGGGAGG + Intronic
1173661364 20:44736325-44736347 ATTGGGAGAAGGAGAGAGGAAGG - Intergenic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174543858 20:51310304-51310326 TTAGGGAGGAGGAGTCAGGCTGG + Intergenic
1174548057 20:51341446-51341468 TGAGTGAGAAGGACAGAGGATGG - Intergenic
1175527465 20:59645366-59645388 TGAGGGAGGTGGAGGGAGGAAGG + Intronic
1175578906 20:60083869-60083891 TTTGGGAGATGGAGTGTGGAAGG + Intergenic
1175754877 20:61523130-61523152 CTAGGGAGAGGGATGGAGGATGG - Intronic
1176365160 21:6028300-6028322 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
1176972958 21:15288109-15288131 TTAGAGAGATGGAGTTAGGAAGG - Intergenic
1177891729 21:26812726-26812748 TCAGGGAGAAGGAGGGAATATGG - Intergenic
1178155750 21:29851979-29852001 TCAGGGAGAAGGATCAAAGATGG - Intronic
1179758358 21:43510245-43510267 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
1180183096 21:46126676-46126698 TTAGGGAGATGGCCCCAGGATGG + Intronic
1180910241 22:19444802-19444824 TTAGGGAGAAGGGAGGAAGACGG + Intronic
1181534279 22:23533692-23533714 AGAGGGCGAAGGAGGGAGGATGG + Intergenic
1182471233 22:30549611-30549633 GAAGGGAGAAGGAGAGAGGGCGG - Intergenic
1183293190 22:37015304-37015326 TGAGGGTGAAGAAGGGAGGAGGG - Intronic
1183809823 22:40246011-40246033 ATAGAGAGAAGGAGCAAGAAAGG + Exonic
1184870823 22:47237435-47237457 GAAGGGAGAGGGAGTGAGGATGG + Intergenic
1185106951 22:48877201-48877223 AGAGGGAGAGGGAGAGAGGAAGG - Intergenic
1185277041 22:49954287-49954309 TCACGGAGAAAGAGCAAGGACGG - Intergenic
949827194 3:8177850-8177872 TAAGGGTGAAGGAGCAAGGCAGG - Intergenic
949996668 3:9622645-9622667 TTAGTGAGAGGAAGGGAGGAGGG + Intergenic
950109332 3:10408462-10408484 TTCCGGAGAAGGAGTTAGGATGG + Intronic
950645581 3:14374673-14374695 GGAGGGAGGAGGAGAGAGGAGGG + Intergenic
950871286 3:16231769-16231791 TGAGAGAGAAGGAGAGAGGGAGG - Intronic
950974772 3:17228914-17228936 TGAGAGAGAAGGAAAGAGGAAGG + Intronic
951194150 3:19804735-19804757 GGAGGGAGGAGGAGGGAGGAGGG + Intergenic
951574053 3:24095473-24095495 TGAGGGAGGAGGAGCCAAGATGG - Intergenic
951670891 3:25180754-25180776 TAGGGGAGAAGGAAAGAGGAAGG + Intronic
951843320 3:27058470-27058492 TTTGGGAGAAGGGGAGAGAAAGG - Intergenic
952569233 3:34694467-34694489 GAAGGGAGAAGGAGGGAGGGAGG - Intergenic
952706218 3:36380480-36380502 GGAGGGAGAGGGAGCGAGGCTGG + Exonic
952721864 3:36541985-36542007 TTAGAGAGAGGGAGGAAGGATGG + Intronic
952962976 3:38604362-38604384 CAAGGGAGAAGGAGGCAGGAAGG + Intronic
953026189 3:39146577-39146599 TTGGGGAGCAGGAGCGAGACTGG + Exonic
953857292 3:46509212-46509234 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
954121851 3:48504246-48504268 GGAGGGAGGAGGAGGGAGGAGGG + Exonic
954876402 3:53805724-53805746 TGAGGGAGGAGGAGGGAAGATGG - Intronic
955340230 3:58119740-58119762 CTAGGGAGAAGGAGAGGTGAGGG - Intronic
955442683 3:58974250-58974272 GTAGGGGGAAGGTGGGAGGACGG - Intronic
956147836 3:66210112-66210134 AAAGGGAGAAGGAGGGAGGAAGG - Intronic
956247950 3:67205121-67205143 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
956369340 3:68541257-68541279 TTCTTGAGAAGGAGGGAGGAGGG - Intronic
956748523 3:72328624-72328646 CAAGGGAGAAGTAGCGGGGAGGG + Intergenic
957405188 3:79766767-79766789 GCAGGGAGAAGGAGCAAGAAGGG + Intronic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
958112150 3:89162524-89162546 TTGAGGAGAAGGAGAGAGGTTGG - Intronic
958126407 3:89361843-89361865 TTAGGGAGAAGTAACAAAGAGGG - Intronic
958532444 3:95350560-95350582 TAAGGGAGAAGGAGAGACCAAGG - Intergenic
959054897 3:101557775-101557797 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
959584475 3:108013393-108013415 GAAGGGAGAAGGAGTGAGCAAGG + Intergenic
960071487 3:113435964-113435986 TTAGGTGGAAGGAAAGAGGAAGG - Intronic
960356180 3:116656185-116656207 GAAGGGAGAGGGAGGGAGGAAGG - Intronic
960558870 3:119059886-119059908 TTAGGGATAAGGAAAGAAGAAGG + Intronic
960717344 3:120589804-120589826 TTGGTGAGAAGGTGAGAGGAAGG + Intergenic
961243623 3:125433415-125433437 TTAGGGAAAAGGAATGAGGCTGG - Intergenic
961266437 3:125646926-125646948 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
962060972 3:131926965-131926987 TTAGGGTGTGGGAGAGAGGAAGG + Intronic
962071044 3:132034293-132034315 TTGGGGAGAAAGACCGCGGAGGG - Intronic
962382430 3:134908710-134908732 GGAGGGAGAAGGCGTGAGGAGGG + Intronic
963100245 3:141595133-141595155 TTTGGGAGGAGGAGAGGGGATGG - Intronic
963456920 3:145556061-145556083 TAAGGGTGAAGGACCAAGGAAGG + Intergenic
963515088 3:146299542-146299564 TAAGGGAGAAAGAGCAAAGAAGG - Intergenic
964278958 3:155041082-155041104 TGAGGGAGAAGAATCAAGGATGG - Intronic
964335141 3:155646727-155646749 TTAGGGAGGAGGTTCAAGGAGGG - Intronic
964501635 3:157354522-157354544 ATAAGGAGAAGCAGCAAGGACGG - Intronic
964738598 3:159942145-159942167 AGAGAGAGAAGGAGGGAGGAAGG + Intergenic
965070089 3:163908365-163908387 TAAGGGTGAAGGAGCAAGGCAGG - Intergenic
965490704 3:169332230-169332252 TCAGGGAAAAGGAGGGAAGAAGG + Intronic
965679171 3:171232744-171232766 TGAGGGAGAAGAAGGGAAGAGGG - Intronic
965765927 3:172129985-172130007 TTGGGGAGAGGGAGGGAGGGAGG + Intronic
966261300 3:177982616-177982638 ATTGGGAGAAGGAGCCAGGAAGG - Intergenic
966916793 3:184588797-184588819 TTAGGGAAGAGGAGTGAGGCAGG + Intronic
967339323 3:188378843-188378865 ATAGGGAGGAGGAGCCAAGATGG - Intronic
968012898 3:195298551-195298573 TTAAGGAAAAGGAGAGAGGCTGG - Intronic
968676381 4:1883080-1883102 TTTGGGATAAGGAGAGATGAGGG + Intronic
968693483 4:2008652-2008674 GTTGGGGGAGGGAGCGAGGAGGG + Intronic
968695053 4:2020339-2020361 AAAGGGAGAGGGAGGGAGGAAGG - Intronic
969232960 4:5844413-5844435 GGAGGGAGAAGAGGCGAGGAAGG + Intronic
969555237 4:7903782-7903804 TGAGGGACAAGGATCCAGGAAGG - Intronic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969620476 4:8276427-8276449 TGAGGGAGAGGGGTCGAGGAAGG + Intronic
970401033 4:15718069-15718091 TTAGGAAAAAGGAGCCAGGCTGG - Intronic
971810526 4:31419829-31419851 TTAGGTAGAAGGAATAAGGATGG - Intergenic
972485816 4:39539396-39539418 TTAGGTAGAAAGAGCAGGGAGGG + Intergenic
972486290 4:39544083-39544105 TTAGGTAGAAAGAGCAGGGAGGG + Intergenic
972583008 4:40411877-40411899 TTGGGGAGAAGGAGCAAGAGGGG - Intergenic
972744490 4:41920381-41920403 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
973835621 4:54806439-54806461 GAAGGGAGAAGGAGAGAGGGAGG + Intergenic
974457903 4:62151768-62151790 TTAAGGTAAAGGGGCGAGGAGGG + Intergenic
974611701 4:64226900-64226922 CTAGGGAGAAGGACAGAGAAAGG - Intergenic
974839893 4:67287407-67287429 TTAGAGAGAAGTAGAGAGAAGGG - Intergenic
974881037 4:67757451-67757473 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
975072609 4:70160365-70160387 TTAAGTAGATGGAGCCAGGAAGG - Intronic
976373418 4:84316571-84316593 TCAGCCAGAAGGGGCGAGGAAGG + Intergenic
977225482 4:94387894-94387916 TAAGGGAGAAGAAGGGAGAATGG + Intergenic
977444279 4:97109678-97109700 TTAGGGAGAAGTGGCCAAGAGGG + Intergenic
979017721 4:115455231-115455253 ATAGGGTGAAGGTGGGAGGAGGG + Intergenic
979187855 4:117821176-117821198 TTAGGCAGAAGGTGAGAGGTAGG - Intergenic
981449218 4:144876570-144876592 CTAGGGAGAAGGAGGGATGGAGG + Intergenic
981623475 4:146730613-146730635 TGAGGAAGAAGGAGCCAGTATGG + Intronic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
981829083 4:148979610-148979632 TTGGGGAGGAGGAGAAAGGAAGG - Intergenic
981953999 4:150447853-150447875 TTTGGGAAAAGGAGTGTGGATGG - Intronic
982345838 4:154357329-154357351 TTAGGGAAAAGGAGCCAGGCTGG + Intronic
982629063 4:157808596-157808618 TTGGGGAGAAAGACAGAGGAGGG + Intergenic
983089107 4:163483451-163483473 TTGAGAAGAAGGAGTGAGGAAGG + Intergenic
983460902 4:168024925-168024947 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
984614359 4:181879297-181879319 GTAGAGAGAGGGAGGGAGGAAGG + Intergenic
984726971 4:183030985-183031007 TTAGGGAAAAGGAGTCAAGATGG - Intergenic
984814773 4:183825892-183825914 ATGGGGAGAAGGCGCGAGAAGGG + Intergenic
985056199 4:186037632-186037654 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
986016406 5:3761370-3761392 CCAGGGAGATGGAGGGAGGAGGG - Intergenic
986398134 5:7351070-7351092 ATTGAGAGAAGGAGGGAGGAGGG - Intergenic
986517940 5:8582777-8582799 GGAGGGAGAAGGAGAGAGGGAGG + Intergenic
987755687 5:22096097-22096119 TAAGGGAGAAGGAGGAATGAAGG - Intronic
988856252 5:35230379-35230401 AGAGGGAGAAGGAGTGAGTAAGG + Exonic
988895205 5:35664809-35664831 AGAGGGAGAGGGAGAGAGGAAGG + Intronic
989056591 5:37371362-37371384 TGAGGAGGAAGGAGGGAGGAGGG + Intergenic
989530535 5:42502912-42502934 TAAAGGAGAAGGAGCAAGGCAGG + Intronic
989955267 5:50351700-50351722 AAAGAGAGAAGGAGGGAGGAAGG + Intergenic
990034607 5:51304487-51304509 TGAGGGAGGAGGAGCCAAGATGG + Intergenic
990180721 5:53157403-53157425 TTGGGGAGAAGAAGCTAGGTAGG + Intergenic
990690247 5:58355743-58355765 TGAGGGGGAAGGAGGAAGGAAGG - Intergenic
990696722 5:58426471-58426493 TTAGGGAGGTAGAGAGAGGAAGG - Intergenic
990786919 5:59431773-59431795 TGAGGGTGAAGGTGGGAGGAGGG - Intronic
990925669 5:61019380-61019402 ATAGGGAAAAGGAGAGAAGAGGG - Intronic
991240912 5:64458910-64458932 TTAGGGAGCAGGATCAATGATGG - Intergenic
991252811 5:64582547-64582569 TTTGGGAGAGGAAGGGAGGATGG - Intronic
992343472 5:75851023-75851045 TTAGGGAAAAGGAGTTAGGCTGG - Intergenic
992605100 5:78447928-78447950 AGAGGGGGAAGGAGGGAGGAAGG - Intronic
992738426 5:79747067-79747089 TTAGGGAGAAAGAGAGAGGAAGG - Intronic
993323919 5:86510687-86510709 TTAGGGAGGAGGAGCCAAGATGG + Intergenic
993407525 5:87529878-87529900 AGAGAGAGAAGGAGGGAGGAAGG - Intergenic
993562253 5:89424586-89424608 TTAGGGGGAAGGATAGAGGTGGG + Intergenic
994276138 5:97840369-97840391 TGAGAGAGAAAGAGAGAGGAAGG - Intergenic
994613596 5:102077201-102077223 TTAGAGAGAAGGAGGGAAGAGGG + Intergenic
994648176 5:102495768-102495790 AAAGGGAGAAGAAGAGAGGAAGG + Intronic
994868125 5:105305537-105305559 ATAGGGATAGGGAGGGAGGAGGG - Intergenic
995446951 5:112255063-112255085 TTAGGGGGAAGGAAAGAGAACGG - Intronic
995649891 5:114358680-114358702 ACAGAGAGAAGGAGAGAGGAAGG - Intergenic
995900439 5:117059530-117059552 TAAGGGACAAAGAGTGAGGAAGG + Intergenic
996032456 5:118721226-118721248 TTGGGGGGAAGGAGGGAGGGGGG + Intergenic
996131034 5:119780781-119780803 TTAGGGGGGAGGAGCCAAGATGG - Intergenic
996445444 5:123543933-123543955 TTAGGGAAAAGGAGTCAGGCTGG + Intronic
998206344 5:140159419-140159441 TTAGGAGGAAGGAGGGAGAAGGG - Intergenic
998394134 5:141807156-141807178 ATAGGGAGAGAGAGGGAGGAAGG + Intergenic
998400285 5:141845274-141845296 TTGGGGAGAAAGAGAGAGTAGGG - Intergenic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998535246 5:142924251-142924273 TTAAGGAGAAGAAGAAAGGAAGG - Intronic
998608687 5:143664142-143664164 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
998984743 5:147743956-147743978 GGAGGGAGAAGGAGGGAGGGAGG - Intronic
999185986 5:149709373-149709395 GTAGGGAGAAGGAGCAGGAAAGG - Intergenic
999456494 5:151720732-151720754 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
1000154092 5:158533837-158533859 TTAGGGTGAAGGAAGGAGGGCGG - Intergenic
1000283048 5:159798857-159798879 CTTGGGAGAAGGAGGGAGAAGGG - Intergenic
1000329867 5:160198030-160198052 GAAGGGAGAAGGAGAGAAGAAGG + Intronic
1000633579 5:163618076-163618098 TTAGTGAGAGGGAGGGAGGGAGG - Intergenic
1001080657 5:168664951-168664973 GGAGGGAGAAGGAGTGAGCAAGG + Intronic
1001089433 5:168726461-168726483 GGAGGGAGAGGGAGGGAGGAAGG + Intronic
1001197908 5:169690315-169690337 TTACAGAGAAGGAGCCAGGGAGG + Intronic
1001265860 5:170274226-170274248 TTTGTGATAAGGAGCCAGGATGG - Intronic
1002004345 5:176219875-176219897 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
1002222025 5:177690754-177690776 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
1002675639 5:180910204-180910226 TTAGGGAAAAGGAGTCAGGCTGG + Intronic
1003003859 6:2362335-2362357 TTAGAGAGAAAGAGAGAGGTGGG - Intergenic
1003126995 6:3363449-3363471 TGAGGGAGAAGGGGAGGGGATGG + Intronic
1003307277 6:4940944-4940966 TTGGGGAGAAGGAGGCAGCAGGG - Intronic
1003423070 6:5975299-5975321 TTAGGGAAAAGGAGTCAGGATGG + Intergenic
1004180710 6:13378553-13378575 TTATCGAGAAAGAGAGAGGATGG + Intronic
1004233320 6:13852021-13852043 AGAGGGAGAGGGAGGGAGGAAGG - Intergenic
1004377892 6:15106483-15106505 TTCAGGAGGAGGAGGGAGGATGG + Intergenic
1004515365 6:16317810-16317832 TTAGGGGGATGGATGGAGGAAGG - Intronic
1004751445 6:18566048-18566070 GAAGGAAGAAGGAGGGAGGAAGG - Intergenic
1005001311 6:21244521-21244543 TTAGGGAGATGGAGGGGAGAGGG - Intergenic
1005727016 6:28659218-28659240 GTTGGGAGAAGGAGCAAGGTGGG + Intergenic
1006265835 6:32922654-32922676 TGAGAGAGAAAGAGAGAGGAAGG - Intergenic
1007422915 6:41730293-41730315 TTATAGGGAAGGAGTGAGGAAGG + Intronic
1007521104 6:42452285-42452307 GGAGGGAGAGGGACCGAGGAGGG + Intergenic
1008046787 6:46859358-46859380 TTTGGGAGAAGGACAAAGGAGGG + Exonic
1009683519 6:66927497-66927519 TTAGGGAGCAAGAGAGAGAAGGG - Intergenic
1009767562 6:68100882-68100904 AGAGGGAGAGGGAGAGAGGAAGG - Intergenic
1010120219 6:72366689-72366711 TGAGGGAGGAGGAGAGAGAATGG + Intronic
1010141049 6:72615233-72615255 TAAGAGAGAAGGAGCAAGTAGGG - Intergenic
1010193338 6:73215168-73215190 TCAGGAAGAAGGAGAGAGGAAGG - Intronic
1010373139 6:75134887-75134909 TTAGTGAGATGGAGAGAGCAAGG - Intronic
1010804371 6:80217618-80217640 TTAGGGAGTAGGGGCAGGGAAGG - Intronic
1011315610 6:86027497-86027519 TTGGGGGGAAGGAGCCAAGATGG - Intergenic
1012989362 6:105909340-105909362 TGAGGGAGAAGGATCGAAGGAGG + Intergenic
1013222489 6:108091372-108091394 TTAGGGAAAAGGAGCCAGACTGG - Intronic
1014303064 6:119707689-119707711 TTAGGGAGAAGGAGAGAGAGAGG + Intergenic
1014412726 6:121146965-121146987 ATAGGGTGATGGAGGGAGGAAGG - Intronic
1014781061 6:125565191-125565213 TTAGGGAGGAGGAGAGAGACTGG - Intergenic
1015314526 6:131803631-131803653 TTAGGGAAAAGGAGTCAGGATGG - Intergenic
1016402897 6:143699793-143699815 TTGGAGAGAAGGAGCGAAAAGGG - Intronic
1016634795 6:146275558-146275580 ATAGGAAAAAGGAGAGAGGAAGG - Intronic
1016724628 6:147348334-147348356 TGAGGGAGAGGGAGGGAGGGAGG - Intronic
1016833411 6:148454521-148454543 TTAGGCAAAAGCAGAGAGGAAGG + Intronic
1017024341 6:150168112-150168134 TTAGGGAGAAGGAGTGGGGGAGG - Intronic
1017115011 6:150967963-150967985 TAAGGGACAAGGAGCGGGAAGGG - Intronic
1018045251 6:159960141-159960163 TTAGGGAGATGGAGCTAGTGAGG - Intergenic
1018717182 6:166542474-166542496 TTTGGGAGGAGGAGCTGGGACGG + Intronic
1018802836 6:167236667-167236689 TTAGTCAGGAGGAGGGAGGACGG + Intergenic
1018807752 6:167274372-167274394 TTAGGCAGGAGGAGGGAGGACGG - Intronic
1019100287 6:169624482-169624504 TTAGGGAGCCGGAGGGAGGCTGG + Intronic
1019327622 7:446066-446088 AAAGGAAGAAGGAGGGAGGAGGG + Intergenic
1019339781 7:503516-503538 GGAGGGTGAAGGAGGGAGGAGGG + Intronic
1019397535 7:830097-830119 TAAGGGGGAAGGAGGAAGGAGGG + Intronic
1019475588 7:1242656-1242678 TCAGGGAGGGGAAGCGAGGAGGG - Intergenic
1020492591 7:8806861-8806883 TTAGGGAGAGGGGGCGGGAAGGG - Intergenic
1021196464 7:17679713-17679735 TTGGGGCGCAGGAGGGAGGAGGG + Intergenic
1021242910 7:18226676-18226698 ATAGGGAGTAGGATTGAGGAAGG + Intronic
1021334313 7:19379885-19379907 ATAGGGAGATGGAAGGAGGAAGG - Intergenic
1022174537 7:27860867-27860889 TTAGGAAAAAGGAGGGACGAGGG - Intronic
1022183004 7:27940103-27940125 GTAGGGAGCAGGTGAGAGGAGGG - Intronic
1022708915 7:32833632-32833654 TAAGGGAGAAGGAGAATGGAGGG - Intergenic
1023159554 7:37284091-37284113 TTAGGGAGATGGAGCAACAATGG + Intronic
1023598020 7:41853121-41853143 TTAGGGAGAAAGAAGGAGTAAGG - Intergenic
1023705124 7:42932889-42932911 AAAGGGAGAATGAGCGAGGCGGG + Intronic
1023808385 7:43891383-43891405 TTAGGGAAAAGGAGTCAGGCTGG + Intronic
1024008028 7:45241642-45241664 TAAGGGAGCAGGGGCGGGGAAGG + Intergenic
1025265032 7:57449693-57449715 TTAGGGAGGCCGAGCGGGGAAGG - Intergenic
1026305292 7:69134990-69135012 AGAGGGAGAAGGAGAGAGGGAGG - Intergenic
1026822198 7:73557354-73557376 TGCGGGAGAAGGCGGGAGGAGGG - Intronic
1026833040 7:73621846-73621868 GGAGGGAGAAGGAGGGAGGGAGG - Intronic
1026839297 7:73660256-73660278 AGAGGGAGAGGGAGGGAGGAAGG - Intergenic
1027254125 7:76419704-76419726 AGAGGGAGAGGGAGGGAGGAAGG - Intronic
1027485559 7:78757282-78757304 GGAGGGAGAAGGAGGGAGGGAGG - Intronic
1027636357 7:80680215-80680237 GTAGGGAGCAGGAGCAAGGGAGG + Intergenic
1027900666 7:84110261-84110283 CTAGGGAGCAGGAGGAAGGAAGG - Intronic
1028405635 7:90470817-90470839 GTTGGGAGAAGGGGCCAGGATGG - Intronic
1028689944 7:93640772-93640794 TAAGGGTGAAGGACCGAGGCAGG - Intronic
1029103410 7:98153312-98153334 TCAGGGAGAAGCAGTGAGGAGGG + Intronic
1029104096 7:98160661-98160683 TTTGGGGGAAGGAGTGTGGAGGG + Intronic
1029263672 7:99322250-99322272 TTAGGGAAAAGGAGTCAGGATGG + Intergenic
1030280407 7:107768879-107768901 AGAGGGAGAGGGAGCGTGGAGGG + Intronic
1030792101 7:113742897-113742919 TTTCGGAGAAGGAGCCAAGATGG + Intergenic
1031083313 7:117278754-117278776 GTAGGGAGAAGGAGCCAGGATGG - Intronic
1031355341 7:120781577-120781599 TAAGGGAGAAGAAGGGAGAATGG + Intergenic
1031477249 7:122238517-122238539 TTAGGGCGGAGGAGCCAAGATGG + Intergenic
1031777088 7:125918399-125918421 TAAGGGTGAAGGAGCAAGGCAGG - Intergenic
1032285067 7:130533523-130533545 TGAGGGAGAAGGTGAGAGGAAGG + Intronic
1032535548 7:132660161-132660183 ATAGGGTGAAGAAGCTAGGAGGG - Intronic
1033080211 7:138289530-138289552 TTAGGGAAAAGGAGTCAGGCTGG - Intergenic
1033120752 7:138664837-138664859 TTGGGGAGAAGGGTCGAGGGCGG - Intronic
1033349713 7:140552352-140552374 AGAGGGAGAGGGAGGGAGGAAGG - Intronic
1033465270 7:141583592-141583614 TAAGGGTGAAGGATCTAGGAAGG + Intronic
1034115791 7:148582708-148582730 TGATGGAGAAGGAAAGAGGAAGG - Intergenic
1035094936 7:156346427-156346449 GCAGGGAGAAGGAGAGAGGATGG + Intergenic
1035237692 7:157509271-157509293 ATGGGGAGAAGGAGAGAGGGGGG + Intergenic
1035404767 7:158589683-158589705 TTAGGGAGAGGGAGAGAGTTAGG - Intergenic
1035896310 8:3406398-3406420 CTAGTGAGAAAGAGCGAGCAGGG + Intronic
1036522055 8:9501025-9501047 TTAGGGAAAAGGAGTCAGGCAGG - Intergenic
1037930234 8:22875467-22875489 TGAGGGGGAAGGTGGGAGGAGGG - Intronic
1039616235 8:38956971-38956993 TTAGAGGGAAGGAGGGAGGCAGG + Intronic
1040681918 8:49820776-49820798 GAAGGGAGACGGAGGGAGGAAGG + Intergenic
1041338641 8:56817092-56817114 TTAGGCAAAAGGAGAAAGGAAGG + Intergenic
1041977141 8:63812909-63812931 TTTGGTAGAATGAGTGAGGAGGG - Intergenic
1042871094 8:73400481-73400503 ATAGTGAGAAGGAACCAGGAGGG - Intergenic
1043272297 8:78350504-78350526 TTAGGGAGGTGGAGCCAAGATGG + Intergenic
1043575404 8:81650642-81650664 TTTGGGAGACTGAGCGGGGAAGG + Intergenic
1043609502 8:82044986-82045008 AAAGGGAGAAGGAGGGAGGGGGG + Intergenic
1043615998 8:82126405-82126427 GTAGGGAGAATGAGACAGGATGG + Intergenic
1044367829 8:91370299-91370321 AGAGGGAAAAGGAGAGAGGAGGG - Intronic
1044768509 8:95603853-95603875 TTAGGGATGGGGAGGGAGGAAGG - Intergenic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1045322015 8:101089296-101089318 ATTGGGAGAAGGAAGGAGGATGG + Intergenic
1045689481 8:104745855-104745877 ATAGGGAGGAGGAGCCAAGATGG - Intronic
1046624318 8:116560643-116560665 TTAGGGGCAGGGAGCGAGGCAGG + Intergenic
1046745386 8:117870475-117870497 TTAAGTAGAAGGAGCAAGGAGGG + Intronic
1047009084 8:120651721-120651743 GTAGGGAGAAGGAGAGAAAAAGG + Intronic
1047291926 8:123539330-123539352 TTAGGAACAAGGAGGAAGGAAGG + Intronic
1047329013 8:123868107-123868129 GAGGGGAGAAGGAGCGGGGAAGG - Intronic
1047521816 8:125600758-125600780 TTGGGGAGCAGAAGGGAGGAGGG + Intergenic
1047989304 8:130268947-130268969 TGAGGGAGGAGGAGGGAGGGTGG + Intronic
1048753813 8:137712081-137712103 TGAGCGAGAAAGAGAGAGGATGG + Intergenic
1048759855 8:137782220-137782242 GTAGAGAGAAGGAGAGAGCAGGG - Intergenic
1048798391 8:138172702-138172724 TTATGCAGAGGGAGGGAGGAAGG + Intronic
1049083207 8:140458159-140458181 GGAGGGAGATGGAGCGAGGAGGG + Intronic
1049149724 8:141026840-141026862 TGAGGCAGCAGGAGCCAGGACGG + Intergenic
1049160128 8:141092074-141092096 TAAGGGAAAAGGAGTGAGGCTGG - Intergenic
1049353432 8:142176347-142176369 TTAGGGAGAGTGAGAGAGCAAGG - Intergenic
1049617892 8:143583875-143583897 CTAGGCAGCAGGAGCGAGGGAGG + Intronic
1049844424 8:144793032-144793054 CGAGGAAGAAGGAGCGGGGATGG + Intergenic
1051339832 9:16101035-16101057 TCAGGCTGAAGGAGCTAGGAGGG + Intergenic
1052133575 9:24882168-24882190 TTTGGAAGAAAGAGAGAGGAGGG + Intergenic
1052492244 9:29184714-29184736 GAAGGGAGAGGGAGGGAGGAGGG - Intergenic
1053001510 9:34579303-34579325 TTAGGCGGAGGGAGGGAGGAGGG - Intronic
1053901001 9:42795535-42795557 TTTGGGAGAAGGACAAAGGAGGG - Intergenic
1054260643 9:62862028-62862050 TTTGGGAGAAGGACAAAGGAGGG + Intergenic
1055484223 9:76741434-76741456 TTAGGGAAAAGGAGTCAGGCTGG + Intronic
1057084107 9:92192784-92192806 TTAGGGAAAAGGAGTCAGGCTGG + Intergenic
1057480347 9:95440489-95440511 GGAGGGAGAAGGGGGGAGGAGGG + Intergenic
1057480355 9:95440506-95440528 GGAGGGAGAAGGGGGGAGGAGGG + Intergenic
1057554107 9:96073908-96073930 ATAGAGGGAAGGAGAGAGGAGGG - Intergenic
1058498538 9:105587293-105587315 TTGGTTAGAAGGAGGGAGGAGGG + Intronic
1058503060 9:105641401-105641423 TCAGGGAGAAGGAACTAGAAAGG + Intergenic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1059285253 9:113166744-113166766 TTAGCTGGAAGGAGCGAGGGTGG - Intronic
1059672323 9:116503171-116503193 GAAGGAAGAAGGAGGGAGGAAGG + Intronic
1059970122 9:119658635-119658657 GTATGGAGAAGGAAGGAGGATGG + Intergenic
1060198154 9:121636427-121636449 TTCAGGAGCAGGAGGGAGGAGGG + Intronic
1060491598 9:124089170-124089192 TCAGGGAGGAGGAGCCAGGATGG + Intergenic
1060839512 9:126782655-126782677 TGAGGGAAAAGGAGTGAGAATGG + Intergenic
1061246188 9:129402229-129402251 AGAGGGTGAAGGAGGGAGGAGGG - Intergenic
1062008510 9:134254386-134254408 GGAGGGAGAAGGAGGGAGGGAGG + Intergenic
1062074763 9:134579830-134579852 AGGGGGAGAAGGAGCGGGGAGGG + Intergenic
1062509533 9:136897303-136897325 TTAGGCAGAAGGAGAGGGCATGG + Intronic
1062588673 9:137263350-137263372 GAAGGGAGAAGGAGGGAGGGAGG - Intronic
1062588704 9:137263429-137263451 TTGGGGGGAAGGAGGGAGGGAGG - Intronic
1185756669 X:2659224-2659246 GGAGGGAGGAGGAGAGAGGAGGG - Intergenic
1185756794 X:2659480-2659502 GGAGGGAGGAGGAGAGAGGAGGG - Intergenic
1186113133 X:6277078-6277100 TAAGGGTGAAGGAGCAAGGCAGG + Intergenic
1186364345 X:8875494-8875516 TCAGGGAGTAGGAGGGAGAAGGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187146222 X:16639917-16639939 TGAGGGAGAGGGAGCGATCAAGG - Intronic
1187352617 X:18534899-18534921 TTAGGGAGAAGGAGCGAGGAAGG + Intronic
1187553110 X:20325785-20325807 GAAGGGAGAAGGAGTGAGGATGG + Intergenic
1187882915 X:23862948-23862970 GAAGGGAGAAGGAGGGAGGGAGG + Intronic
1190056171 X:47182138-47182160 TGAGGGAGGAGGAGGGAAGAGGG - Intronic
1190178071 X:48167751-48167773 AGAGGGAGAAGGTGCCAGGAAGG + Intergenic
1190232186 X:48590655-48590677 TTGAGGAGAGGGGGCGAGGACGG + Intronic
1190701870 X:52995414-52995436 TCAGGCAGCGGGAGCGAGGAGGG - Intronic
1194302832 X:92208933-92208955 TTAGGGAGAGGGAGTGAAGAAGG + Intronic
1194351036 X:92825309-92825331 TAAGGGTGAAGGAGCAAGGCAGG - Intergenic
1194804479 X:98310423-98310445 GGAGAGAGAAGGAACGAGGATGG + Intergenic
1194998726 X:100621249-100621271 TTAGTGAGAAGGTGCAAGAATGG + Intergenic
1195006454 X:100690208-100690230 ATAGGTAGAAGGAGTGAGTAAGG + Intronic
1196124223 X:112082351-112082373 AGAGGGAGAAGGAGGGAGGAAGG + Exonic
1197707503 X:129645095-129645117 TCAGTGAGAAGCAGAGAGGAGGG - Intergenic
1199235609 X:145488807-145488829 TGAGGGAGAATGAGCAAGGGCGG + Intergenic
1200136786 X:153879132-153879154 TAAGGGCAAAGGAGCGGGGAGGG + Intronic
1201146181 Y:11066744-11066766 TGAGAGGGAAGGAGGGAGGAGGG + Intergenic
1201256345 Y:12111992-12112014 GAAGGGGGAAGGAGGGAGGAAGG - Intergenic