ID: 1187354611

View in Genome Browser
Species Human (GRCh38)
Location X:18555277-18555299
Sequence CTAGTTCAATAGTTCTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187354611 Original CRISPR CTAGTTCAATAGTTCTCCCT TGG (reversed) Intronic
903320505 1:22540421-22540443 CCAGTTTAATTTTTCTCCCTGGG - Intergenic
905100203 1:35514086-35514108 CTAGTCTATTAGTTCTTCCTGGG + Intronic
907529180 1:55076113-55076135 CTAGATCTATAGTTCTCTGTGGG + Intronic
911095082 1:94048272-94048294 CTAGTTCTGTATTTCTCCCAAGG - Intronic
919153902 1:193735935-193735957 CTGGCTCAGTAGTTCTCTCTGGG + Intergenic
919298149 1:195727564-195727586 CTAGTTAAATAATTCTCATTTGG + Intergenic
921791221 1:219292829-219292851 CTAGTTCAATAGCTCTTCTATGG - Intergenic
923382239 1:233432950-233432972 CTAGGCCAAGAGTTTTCCCTAGG + Intergenic
1063882818 10:10548598-10548620 GTAGATCAATAATTTTCCCTAGG + Intergenic
1064570327 10:16685835-16685857 CCACTTTAATAGTTCTCTCTGGG - Intronic
1067458972 10:46443566-46443588 CTGGGTCAATAGTTCTGCCTGGG + Intergenic
1067628225 10:47941066-47941088 CTGGGTCAATAGTTCTGCCTGGG - Intergenic
1071174922 10:82914879-82914901 CTGGTACAATAGTTTTCTCTGGG + Intronic
1073340036 10:102737382-102737404 CTAGTTCAATACTACTTCCATGG + Intronic
1078570015 11:12449626-12449648 CTAGATCAGTAGTTCTCCATGGG + Intronic
1078756692 11:14217893-14217915 CTAGGTCAATGGTTCTCCCTTGG + Intronic
1080723337 11:34870673-34870695 TTAGTTCCAGAGCTCTCCCTGGG - Intronic
1083244583 11:61416379-61416401 CTACTTCAATCGTCCTCCTTCGG - Exonic
1084336912 11:68463785-68463807 CTAGTTCAAGAGTTCTCAGTTGG + Intronic
1084587776 11:70073127-70073149 CTGGTTCAATTCTTCTTCCTGGG - Intergenic
1086507029 11:87515837-87515859 TTAATTCAGTAGTTCTCACTAGG - Intergenic
1088164602 11:106918154-106918176 GCAGTTCACTAGTTCTCCTTGGG + Intronic
1089041218 11:115452000-115452022 TTCCTTGAATAGTTCTCCCTCGG - Intronic
1091181586 11:133609365-133609387 TTAGTTTAGTAGTTCTCACTTGG + Intergenic
1091462081 12:651266-651288 CTGGTTAAATAGTTCTCCTGAGG - Intronic
1092192726 12:6532751-6532773 CTACGTCAGTAGTGCTCCCTGGG + Intergenic
1093767414 12:22981092-22981114 ATTGTTCAATAGTTCTCTCTTGG - Intergenic
1093842080 12:23916296-23916318 CTAGTTCAATTGTTTTCTCTTGG - Intronic
1096445025 12:51681739-51681761 CTAGCTCAATACTTTTCCATTGG + Intronic
1100634004 12:96417478-96417500 ATAGTTCAATAGTGCTTTCTTGG - Intergenic
1103468573 12:121161962-121161984 CTATTTAATTAATTCTCCCTTGG + Intronic
1109524207 13:63554772-63554794 CTTTTTCAAGAGTTCTCACTAGG + Intergenic
1113165496 13:107436046-107436068 CTAGGTCAAAAGTTCTCCGAGGG + Intronic
1115370933 14:32614004-32614026 ATAGTTAAAAAGTTCTCACTAGG - Intronic
1116142558 14:41017216-41017238 CTATATCAATTGTTCACCCTGGG - Intergenic
1116391750 14:44400112-44400134 ATAGTTGAATAGTACTCCATTGG - Intergenic
1121665438 14:95668521-95668543 ATATTTCAATAGTTATCCCCAGG + Intergenic
1124067382 15:26357329-26357351 ATATTTCAATAGTTCTATCTTGG - Intergenic
1127683501 15:61319646-61319668 TTAATTCAATAGGTCTGCCTTGG + Intergenic
1133125208 16:3641883-3641905 CTGGTTCCACAGTTCTCCCCAGG - Intronic
1142948764 17:3460228-3460250 CTAGTTCAATTTTTTTCCCATGG + Intronic
1148568588 17:48648113-48648135 ATATTTCAACAGTTCTCACTTGG - Intergenic
1149153244 17:53594686-53594708 CTAGTTCAATAGTAAACACTAGG + Intergenic
1153131822 18:1862422-1862444 ATAGTTCAATAGTTTTCTTTTGG - Intergenic
1153152378 18:2110052-2110074 CAAGGTCAATAGTTCCCACTGGG - Intergenic
1154489083 18:14905304-14905326 CAAGTCCAAGAGTCCTCCCTTGG + Intergenic
1155729916 18:29143322-29143344 GTATTTCAATAGTTTTCACTTGG - Intergenic
1155732426 18:29177978-29178000 CTACTACATTAGTTCTGCCTAGG + Intergenic
1158020875 18:52840029-52840051 CTCGTTCATTAGTTCTCCAGTGG + Intronic
1158134833 18:54196543-54196565 CTATTTCCATAGTTCTCCCAAGG - Intronic
1158414892 18:57241535-57241557 CTACTTCAAAAGTTGTCCCAAGG + Intergenic
1168358963 19:55722102-55722124 CTAGCTCAGTAGTTCTCAATGGG - Intronic
926940795 2:18134496-18134518 CTGGTTCAATACTTCAACCTAGG - Intronic
928376583 2:30779269-30779291 CTACTCTAATATTTCTCCCTGGG + Intronic
929732891 2:44514603-44514625 CAATCTCAATAGTTCTTCCTTGG - Intronic
933729327 2:85445289-85445311 CTGGCTCAGTTGTTCTCCCTGGG - Intergenic
935790146 2:106583606-106583628 CTAGATCAACAGTACTCCCAAGG - Intergenic
937837406 2:126486103-126486125 CTAGTTGCATATTTCTCCTTGGG + Intergenic
942673618 2:178403603-178403625 TTCATTCAATAATTCTCCCTTGG + Intergenic
946052816 2:216878354-216878376 CTAGGTCCATTGTTCTCCCCCGG + Intergenic
946873097 2:224102229-224102251 CTGGTTCAATAATTCTTCATTGG - Intergenic
948736088 2:240005992-240006014 CTAGATCATTAGGTCTCTCTAGG - Intronic
1170022424 20:11851056-11851078 CTTGTTCAATAGGTCTCCTTGGG + Intergenic
1171184577 20:23116161-23116183 CTAGTTCAATGTTTTTACCTTGG + Intergenic
1174070310 20:47895022-47895044 CTAGTACAAGACCTCTCCCTGGG - Intergenic
1178764293 21:35434685-35434707 CAACTTCATTAGTTTTCCCTAGG + Intronic
949185177 3:1182208-1182230 CTAGTTTTATTTTTCTCCCTTGG - Intronic
951648022 3:24915553-24915575 CTAGTTCAAAATTTCTCCAATGG - Intergenic
954595417 3:51819999-51820021 CAAGTTCAAAAGCTCTCCCTGGG + Intronic
955986964 3:64583676-64583698 ATAATTCAATAGTTCTCAATTGG - Intronic
956452718 3:69390362-69390384 CTAGTTCAATGGTTCTCAACCGG + Intronic
956517500 3:70065592-70065614 CTACTGCAAGAGTTCTCCCTGGG + Intergenic
956662957 3:71617212-71617234 TTAGGTCTATAGTTCTCACTTGG - Intergenic
957186107 3:76943450-76943472 CTAATTCAAAAGTTCACTCTGGG - Intronic
959796170 3:110430771-110430793 CCAGTTCAATAGTTCTAGATAGG - Intergenic
968535180 4:1122129-1122151 CCTGTTCAATAGTTATCTCTCGG - Intergenic
969069204 4:4519739-4519761 CTTGTTCAATAATTCTACCATGG - Intronic
971636115 4:29060585-29060607 ACAGTTCAATATTTCTCACTTGG - Intergenic
975950984 4:79771160-79771182 CTTGTCCAATTGTTCTGCCTAGG - Intergenic
980851001 4:138381351-138381373 GTAGTTCATTAGTGCTACCTTGG + Intergenic
981162652 4:141517200-141517222 CTAGCTTAATCCTTCTCCCTTGG - Intergenic
981217169 4:142183664-142183686 CAAGTTCAAAAGTTCCTCCTTGG + Intronic
986823158 5:11491326-11491348 ACAGTTCAATAGTGCTTCCTGGG + Intronic
987582044 5:19806565-19806587 CTAGTTCAATATTCCTTCTTCGG + Intronic
990280457 5:54245532-54245554 CAAGTTCAAAAATGCTCCCTGGG + Intronic
991028117 5:62052499-62052521 CAAGTCCAACAGTTCTCCCAAGG + Intergenic
992490121 5:77234551-77234573 CTAGTTTCAGAGTGCTCCCTCGG - Intronic
994360966 5:98847841-98847863 CTAAATCAATAGTTCACTCTTGG - Intergenic
998965920 5:147540086-147540108 TTAGTTGAGTAGTTCTCTCTTGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1001192964 5:169647592-169647614 CAAGCTCACCAGTTCTCCCTGGG + Intronic
1001386520 5:171343895-171343917 CTAGTTCAATAGTTCAATTTAGG + Intergenic
1003233421 6:4275074-4275096 CTTGTACAATATTTTTCCCTAGG - Intergenic
1004972590 6:20928273-20928295 ATTGTTCAATAGTTCTTCATGGG + Intronic
1008404000 6:51098753-51098775 CTAGCAGAATATTTCTCCCTAGG - Intergenic
1010032284 6:71283837-71283859 CTAGGTCAGGAGCTCTCCCTAGG + Intergenic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1012637044 6:101556557-101556579 ATAGTTCAATAATTTTCCTTTGG - Intronic
1020342106 7:7123213-7123235 CTTGTTCATTTCTTCTCCCTTGG + Intergenic
1020555171 7:9662012-9662034 CTAGTTCACTAGTTCACTATTGG - Intergenic
1022678791 7:32524807-32524829 CTAGTCCAGTAGTTATCACTGGG - Intronic
1022922163 7:35026510-35026532 CTGATTCAATAGATCTCACTTGG + Intronic
1027384192 7:77644207-77644229 ATAGTTCATTTATTCTCCCTGGG - Intergenic
1027883454 7:83872825-83872847 CTAGCTCCAGAGTTCCCCCTGGG + Intergenic
1030899455 7:115104326-115104348 CTAGCTCCAGAGTTCTCCATAGG + Intergenic
1038747774 8:30269201-30269223 CTTGTTTCATAGTTGTCCCTTGG + Intergenic
1043206326 8:77447400-77447422 ATAGTTCCATAGTGCTCCATAGG - Intergenic
1043948193 8:86277887-86277909 CTAGTCCAGTAGTTGTCACTGGG + Intronic
1047706049 8:127500635-127500657 CTAGTTAAATAGTGGTGCCTGGG + Intergenic
1047889334 8:129290615-129290637 CTAATTCAGTAGTTTTCCATCGG - Intergenic
1048387997 8:133931042-133931064 CTATTTCAATTGTGCACCCTAGG + Intergenic
1048957208 8:139546988-139547010 CCAGTTCACCATTTCTCCCTAGG - Intergenic
1050821350 9:9883817-9883839 CTACTTCAGTTGTTTTCCCTTGG - Intronic
1186524636 X:10237271-10237293 GTAATTCAATAGTTCTCCTTGGG - Exonic
1187007168 X:15243828-15243850 CTAGTTCAGTGGTTCTCCACTGG - Intronic
1187354611 X:18555277-18555299 CTAGTTCAATAGTTCTCCCTTGG - Intronic
1189117928 X:38362479-38362501 TTATTTCAATATTTTTCCCTTGG - Intronic
1193292584 X:79793058-79793080 ATAGTGCAAAAGTTCTCCTTTGG - Intergenic
1195641666 X:107182374-107182396 CTAGTTCAGTAGTTCTCAGCTGG - Intronic
1197317702 X:124988436-124988458 CTAGTTCAAAAGTTCCCTTTTGG - Intergenic