ID: 1187354755

View in Genome Browser
Species Human (GRCh38)
Location X:18557458-18557480
Sequence AGTATCTACGAGGATATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187354755_1187354759 8 Left 1187354755 X:18557458-18557480 CCCTCTATATCCTCGTAGATACT 0: 1
1: 0
2: 1
3: 3
4: 68
Right 1187354759 X:18557489-18557511 ACTGTTATAACCTTTTGAAATGG 0: 1
1: 0
2: 1
3: 30
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187354755 Original CRISPR AGTATCTACGAGGATATAGA GGG (reversed) Intronic
901568623 1:10140749-10140771 AGTATCTTCTAGGACATAGTTGG + Intronic
910770358 1:90824698-90824720 AGAATATACGAGGATATGGGAGG - Intergenic
916258505 1:162815721-162815743 AATATCTTCCAGAATATAGAAGG - Intergenic
920625835 1:207597847-207597869 AGTATCTACGAGCAGATGAATGG + Intronic
924557678 1:245131576-245131598 AGTATCACTGAGGAAATAGAGGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1068244633 10:54348380-54348402 AGTACCTATGAGGACATCGAGGG + Intronic
1068625349 10:59240174-59240196 GGTATCTACCAGGAAATATATGG - Intronic
1071239545 10:83689858-83689880 AGTATCAAAAAGGATCTAGATGG + Intergenic
1080315510 11:30943368-30943390 AGTAGCTACCAGAATAAAGAGGG - Intronic
1083076656 11:60046790-60046812 AGAGTCCACGAGGATCTAGAAGG + Intronic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1089111145 11:116057671-116057693 AATATCAGCAAGGATATAGATGG - Intergenic
1093744435 12:22723623-22723645 AGTGTCTAAGTGGGTATAGAAGG - Intergenic
1100389385 12:94134635-94134657 AGTTTCTACCAGGAAAAAGAGGG + Intergenic
1101192348 12:102348081-102348103 AGTTTCTAGGAGGATATGCATGG - Intergenic
1108005236 13:45939708-45939730 AGTTTCTACAAGGACAGAGAGGG - Intergenic
1109017557 13:57038239-57038261 CTTATCTATCAGGATATAGATGG + Intergenic
1112852289 13:103721101-103721123 ATTATCTAAGAGGTTATACATGG + Intergenic
1115439486 14:33415806-33415828 AGTATCTAATAGGATGTAAAGGG - Intronic
1121308518 14:92922691-92922713 AATATCTAGGAGGCTCTAGAGGG - Intergenic
1127111324 15:55674400-55674422 ACTTTCTTCAAGGATATAGAGGG + Intronic
1130345688 15:83042784-83042806 AGTATCTTAGATGATATACATGG + Intronic
1138991955 16:62401275-62401297 AGTATCTAGGAAGATATAGATGG + Intergenic
1148289858 17:46435569-46435591 AGAATCTAAGAGGATCTACATGG - Intergenic
1148312026 17:46653141-46653163 AGAATCTAAGAGGATCTACATGG - Intronic
1152053967 17:78007198-78007220 AGTATTTTAGAGGATATAGAAGG - Intronic
1166359265 19:42245887-42245909 AGGATCTCAGAGGATATGGATGG + Intronic
1167743303 19:51337510-51337532 AGCCTCCACGAGGATATGGAGGG + Exonic
924989552 2:300747-300769 AGCATCTAAGAGGATATGGGTGG - Intergenic
925644021 2:6017670-6017692 AGAATCCACGAGGAGAAAGAAGG - Intergenic
928626428 2:33144208-33144230 AGCATCAAGAAGGATATAGAAGG + Intronic
938997109 2:136691745-136691767 AGACTCCAAGAGGATATAGATGG + Intergenic
940474099 2:154138342-154138364 AGAATGTAAGAGGATAAAGAAGG + Intronic
940754458 2:157666229-157666251 AGTATCAATGAAGATATGGAAGG + Intergenic
945539139 2:211061815-211061837 AGTAATTACCAGGATATAGCAGG - Intergenic
1173094988 20:40017533-40017555 ATCATCTACGAGGAAATGGATGG - Intergenic
1174224773 20:48988578-48988600 AGCATCTATGAAGAGATAGAAGG + Exonic
1182145512 22:27994632-27994654 AGTATCCAGGAGGAGTTAGAAGG + Intronic
952643503 3:35626741-35626763 AATATCAATGAGGATATAAATGG - Intergenic
953061408 3:39431085-39431107 AGTATCTACCAGGAAAGAGTAGG + Intergenic
957493156 3:80955809-80955831 AGAATCTACGAAGACATAAATGG - Intergenic
959854676 3:111137593-111137615 AGTAAATACGAGGACAAAGATGG - Intronic
964938433 3:162123677-162123699 AGTATCTCCCTGGATCTAGAAGG - Intergenic
982570531 4:157045341-157045363 AGCATCTTCGAGGTTTTAGATGG + Intergenic
989845884 5:46140388-46140410 AGAATCTGCGAGGAGATATATGG + Intergenic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
990451206 5:55933232-55933254 AGTAGGTGCCAGGATATAGAAGG + Intergenic
993238770 5:85351805-85351827 AGTATCTACGTGGATGTAACTGG + Intergenic
993263135 5:85687307-85687329 ACATTCTAGGAGGATATAGAAGG - Intergenic
995619730 5:114011476-114011498 AATCTCTAGGAGGAAATAGAAGG - Intergenic
996595116 5:125191945-125191967 ACTGTCTACCATGATATAGAGGG + Intergenic
996686426 5:126286498-126286520 AATATCTACCAGAAAATAGAAGG + Intergenic
996924123 5:128802789-128802811 AGTATCTATTAGGAAAAAGAAGG + Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
999019255 5:148145063-148145085 AGCCTCTACAAGGATAGAGAAGG + Intergenic
999409290 5:151336344-151336366 GGTAGCGAGGAGGATATAGATGG - Intronic
1000570398 5:162905571-162905593 AATAACTAAAAGGATATAGAAGG + Intergenic
1003120757 6:3317455-3317477 AGTATCTAGGAGCATCTAGGAGG - Intronic
1005472484 6:26175337-26175359 GGGATCTAGGAGGAAATAGAAGG + Intergenic
1006256436 6:32836194-32836216 AGTATCTATGATGACAGAGAAGG - Intronic
1011947391 6:92923297-92923319 AGTATTTACCAGGATTTGGAGGG - Intergenic
1012601649 6:101105790-101105812 AGTATATACAAGCATATATAAGG + Intergenic
1018292787 6:162310103-162310125 AGTCTGTATGAGAATATAGACGG + Intronic
1033289256 7:140068684-140068706 AATATCAGCAAGGATATAGAAGG + Intergenic
1038953762 8:32445185-32445207 AGTATTCAGGAGGATATACAAGG - Intronic
1044380872 8:91531831-91531853 AGTATATACCAGCATCTAGAAGG + Intergenic
1050494945 9:6230731-6230753 AGGATCTATGAGGATATAGTGGG - Intronic
1056529109 9:87471195-87471217 AGTAACTACCAGGAGATAAAGGG - Intergenic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1194001094 X:88429429-88429451 AGCATCAATGAGGATATTGATGG - Intergenic
1199748991 X:150796602-150796624 AAAATCTACAAGGATATTGAAGG + Intronic
1201424508 Y:13833478-13833500 AGAAATTATGAGGATATAGATGG - Intergenic