ID: 1187354756

View in Genome Browser
Species Human (GRCh38)
Location X:18557459-18557481
Sequence CAGTATCTACGAGGATATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187354756_1187354759 7 Left 1187354756 X:18557459-18557481 CCTCTATATCCTCGTAGATACTG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1187354759 X:18557489-18557511 ACTGTTATAACCTTTTGAAATGG 0: 1
1: 0
2: 1
3: 30
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187354756 Original CRISPR CAGTATCTACGAGGATATAG AGG (reversed) Intronic
908775429 1:67634784-67634806 CAGTTTCTACGGTGAAATAGAGG + Intergenic
920969128 1:210727514-210727536 CATTGTCCACGAGGAAATAGTGG + Intronic
1076347181 10:129787270-129787292 CAGTATCTAACAGGATGTTGTGG - Intergenic
1088220352 11:107564241-107564263 CAATATCTAGTAGGATATATTGG - Intronic
1089302713 11:117508202-117508224 CAGGATCTGAAAGGATATAGGGG - Intronic
1091914064 12:4255263-4255285 CAGTATCAATGAGGATATCGAGG + Intergenic
1102092908 12:110208391-110208413 CAGTATCTGGGAGGCTAAAGTGG + Intronic
1108005237 13:45939709-45939731 CAGTTTCTACAAGGACAGAGAGG - Intergenic
1115439487 14:33415807-33415829 CAGTATCTAATAGGATGTAAAGG - Intronic
1121308519 14:92922692-92922714 CAATATCTAGGAGGCTCTAGAGG - Intergenic
1121624551 14:95374705-95374727 CAGTATCAAGGAAGATACAGGGG - Intergenic
1127111323 15:55674399-55674421 CACTTTCTTCAAGGATATAGAGG + Intronic
1140663899 16:77212113-77212135 CAGCATCTGCGAGGACAAAGAGG - Exonic
1146138603 17:30345066-30345088 CAGCATCTAGGAGGAAGTAGTGG + Intergenic
1150565874 17:66339139-66339161 CAGTATCAACCAAGAGATAGAGG + Intronic
1152249121 17:79202414-79202436 CAGACTCTACCAGGATACAGAGG - Intronic
1165323353 19:35099736-35099758 CAGTACCCAGGCGGATATAGCGG - Intergenic
929243866 2:39681115-39681137 CAGTATAAACGAGGAAATTGGGG - Intronic
935733982 2:106091514-106091536 CAGTATCTAAGAGGGTGTAGTGG + Intergenic
938343957 2:130553638-130553660 CAGTCTATCCGAGGAAATAGAGG + Intergenic
938345876 2:130567084-130567106 CAGTCTATCCGAGGAAATAGAGG - Intergenic
938683580 2:133715868-133715890 CAGTAGCTATGAGGATACACTGG + Intergenic
940954031 2:159708860-159708882 CAGTATTTAAAAGGATATAGAGG - Intergenic
943875015 2:193055787-193055809 CAGTATCTGAGTTGATATAGTGG + Intergenic
1169986760 20:11453504-11453526 TAGAATTTACTAGGATATAGGGG - Intergenic
952876962 3:37954177-37954199 CCGTATCTATCAGGAAATAGAGG + Intronic
963389796 3:144646464-144646486 AAGTATTTGTGAGGATATAGAGG - Intergenic
963647972 3:147941214-147941236 CAGTTTTTATGAGGTTATAGAGG + Intergenic
971005230 4:22366260-22366282 CGGTATCTATGAGGAAATTGAGG + Intronic
985476120 5:80189-80211 CATTCTCTAAGAGGATATGGGGG + Intergenic
985476139 5:80269-80291 CATTCTCTAAGAGGATATGGGGG + Intergenic
987828957 5:23071505-23071527 CAGTTTCTGAGAGGAGATAGAGG - Intergenic
990227337 5:53669388-53669410 CAGTATTAACGAGGTTGTAGAGG - Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
1009361580 6:62821159-62821181 CAGTATTTCAGAGGATATGGGGG - Intergenic
1011315994 6:86031953-86031975 CAGCATCTACGAGGACAGAGAGG - Intergenic
1018279452 6:162169862-162169884 TTGTATCTAGGAGGATATGGGGG + Intronic
1037015852 8:13905211-13905233 CTGTATCTATGACTATATAGGGG - Intergenic
1044435714 8:92160336-92160358 CAGCATCTAGGAGGAGAAAGAGG + Intergenic
1047707302 8:127512589-127512611 CAGATTCTAAGAGGATAGAGGGG - Intergenic
1048098131 8:131316516-131316538 CAGTATGTACGGGGGTAAAGAGG - Intergenic
1050494946 9:6230732-6230754 GAGGATCTATGAGGATATAGTGG - Intronic
1051207107 9:14699554-14699576 CAGAATGGAGGAGGATATAGTGG + Intergenic
1055060662 9:72065309-72065331 CAGTATCTACCAGAATACAAGGG - Intronic
1055970367 9:81905874-81905896 CAGTTTCTACCAGCTTATAGAGG - Intergenic
1055979335 9:81986623-81986645 CAGTATCTGCCAGCATATAGAGG - Intergenic
1056885888 9:90443351-90443373 CAGTAGCAACCAGGATATACTGG - Intergenic
1058102057 9:100927180-100927202 CAGACTCTAAGAGGATGTAGAGG + Intergenic
1059206803 9:112474804-112474826 CACTATCTACTTGGAGATAGTGG - Intronic
1187354756 X:18557459-18557481 CAGTATCTACGAGGATATAGAGG - Intronic
1189931508 X:46016767-46016789 CAGTATATACGAGGAAACTGAGG - Intergenic
1192472755 X:71413509-71413531 CAGTATCAAGGAGGAAAAAGTGG - Intronic
1197802847 X:130370174-130370196 CAATATTTATGAAGATATAGTGG - Intronic