ID: 1187354759

View in Genome Browser
Species Human (GRCh38)
Location X:18557489-18557511
Sequence ACTGTTATAACCTTTTGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 338}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187354756_1187354759 7 Left 1187354756 X:18557459-18557481 CCTCTATATCCTCGTAGATACTG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1187354759 X:18557489-18557511 ACTGTTATAACCTTTTGAAATGG 0: 1
1: 0
2: 1
3: 30
4: 338
1187354754_1187354759 9 Left 1187354754 X:18557457-18557479 CCCCTCTATATCCTCGTAGATAC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1187354759 X:18557489-18557511 ACTGTTATAACCTTTTGAAATGG 0: 1
1: 0
2: 1
3: 30
4: 338
1187354755_1187354759 8 Left 1187354755 X:18557458-18557480 CCCTCTATATCCTCGTAGATACT 0: 1
1: 0
2: 1
3: 3
4: 68
Right 1187354759 X:18557489-18557511 ACTGTTATAACCTTTTGAAATGG 0: 1
1: 0
2: 1
3: 30
4: 338
1187354752_1187354759 17 Left 1187354752 X:18557449-18557471 CCAGTGGCCCCCTCTATATCCTC 0: 1
1: 1
2: 0
3: 7
4: 146
Right 1187354759 X:18557489-18557511 ACTGTTATAACCTTTTGAAATGG 0: 1
1: 0
2: 1
3: 30
4: 338
1187354751_1187354759 24 Left 1187354751 X:18557442-18557464 CCTGGAACCAGTGGCCCCCTCTA 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1187354759 X:18557489-18557511 ACTGTTATAACCTTTTGAAATGG 0: 1
1: 0
2: 1
3: 30
4: 338
1187354758_1187354759 -2 Left 1187354758 X:18557468-18557490 CCTCGTAGATACTGAGGAATAAC 0: 1
1: 0
2: 6
3: 76
4: 338
Right 1187354759 X:18557489-18557511 ACTGTTATAACCTTTTGAAATGG 0: 1
1: 0
2: 1
3: 30
4: 338
1187354753_1187354759 10 Left 1187354753 X:18557456-18557478 CCCCCTCTATATCCTCGTAGATA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1187354759 X:18557489-18557511 ACTGTTATAACCTTTTGAAATGG 0: 1
1: 0
2: 1
3: 30
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187354759 Original CRISPR ACTGTTATAACCTTTTGAAA TGG Intronic
905238547 1:36566855-36566877 ACTGTTATTTACGTTTGAAAAGG + Intergenic
905610760 1:39349187-39349209 GCTGTTATTATCTTTGGAAATGG - Intronic
905968527 1:42120474-42120496 ATTGTTATAACTTATTGAATGGG + Intergenic
906366795 1:45216998-45217020 ACTGATATCCCCTTTTGAGAAGG - Intronic
906588081 1:46997985-46998007 ACTTTTATGTCCTTTTGAGAAGG + Intergenic
907783342 1:57587579-57587601 ACTATTATAACCTTGTGGTAAGG - Intronic
908216672 1:61960878-61960900 ACAGTTATATCTTCTTGAAAGGG + Intronic
909350598 1:74648661-74648683 AATACTATAACATTTTGAAAAGG + Intronic
910318524 1:85917179-85917201 AATGATGTATCCTTTTGAAAAGG - Intronic
910330217 1:86064887-86064909 ACTGTTTTTACATTTTTAAAGGG + Intronic
910345378 1:86230348-86230370 CCTGGTTTAACCTCTTGAAAAGG + Intergenic
911787922 1:101973964-101973986 ACTGTAATAATCTTTTTTAAGGG - Intronic
912074397 1:105854147-105854169 ATTGTTATAACTTTTCTAAATGG - Intergenic
912523245 1:110261764-110261786 ATTCTTATAACACTTTGAAATGG + Intronic
913090462 1:115473346-115473368 ACTGTTGTCAGCTTTTGAGAAGG + Intergenic
913295705 1:117317751-117317773 ATGGTTAAAACCATTTGAAAAGG - Intergenic
913555036 1:119957402-119957424 TCTCTTAGAACCTTTTTAAATGG - Intronic
914796240 1:150923039-150923061 ATTGTTACAACCTTTTAGAAAGG + Intergenic
914963136 1:152224661-152224683 ATTGTTATTACCTTTTGAATTGG + Intergenic
915523634 1:156463251-156463273 ACTGTTAAAGCACTTTGAAAGGG + Intergenic
917143596 1:171863509-171863531 ACTGTTATTGGCTTATGAAAAGG - Intronic
918198698 1:182246907-182246929 ATGGTTTTTACCTTTTGAAATGG - Intergenic
918961671 1:191285510-191285532 AACGTTATATCTTTTTGAAAAGG + Intergenic
919508329 1:198428509-198428531 CCAGTTTTAACTTTTTGAAATGG + Intergenic
919722513 1:200853981-200854003 ACTATTATTATTTTTTGAAACGG + Intronic
922247664 1:223816702-223816724 ACTGATATAACCTTTGCAGAAGG + Intronic
922444005 1:225681208-225681230 ACTGTCTTAATTTTTTGAAAGGG - Intergenic
922631305 1:227115143-227115165 ACAGTTAAAAACTTTTGAGAAGG + Intronic
923148783 1:231216055-231216077 AGTGTTAGAACCTTTTAAAATGG + Exonic
923370273 1:233304110-233304132 ACTCTTAAAACTTTTTTAAAGGG + Intergenic
923991446 1:239441601-239441623 ACTGTTAGCACATTTTGGAAAGG + Intronic
1063697288 10:8348986-8349008 ACTGTTAAAAACGTTTTAAAGGG - Intergenic
1064002894 10:11678169-11678191 AATGTTTTTACATTTTGAAATGG + Intergenic
1064381956 10:14851666-14851688 ACTGTTATATACATTTGACAGGG + Intronic
1065632936 10:27699551-27699573 ACAGTTGTAATCTGTTGAAATGG + Intronic
1068470582 10:57457142-57457164 ACCGTTATAATCATTTTAAAAGG - Intergenic
1068472668 10:57484723-57484745 ACTGATATTAACTTTGGAAAAGG + Intergenic
1068548659 10:58381905-58381927 ACTGTGATAAGCACTTGAAAGGG - Intergenic
1068568447 10:58602021-58602043 ACTTTTATTACCTTTTTAGAAGG + Intronic
1070450366 10:76551862-76551884 ATTGTTATCACCTTTTGCAGGGG + Intronic
1070853633 10:79587347-79587369 ACTGTTGTAAGCTCTTGAGAGGG + Intergenic
1070858132 10:79625203-79625225 ATTTTTCTAACGTTTTGAAATGG + Intergenic
1071473246 10:86002543-86002565 ACTGTAATAATTTTGTGAAAAGG - Intronic
1072557224 10:96529428-96529450 AATTTTATAACTTTTTAAAAGGG - Intronic
1072707240 10:97689450-97689472 ACTGTAAAAACCTTTTTAACGGG - Intergenic
1075502440 10:122987935-122987957 AGTGTTCTAAGCTTTTGTAAAGG - Intronic
1079493316 11:21013197-21013219 ACTGTTCTAATTTTTTGCAAAGG + Intronic
1079505187 11:21145404-21145426 ACTATTATAATCATTTAAAATGG + Intronic
1079862450 11:25690995-25691017 ATTGTTATATTCTCTTGAAAAGG - Intergenic
1079876776 11:25868003-25868025 GCTGTCATAACCTTCTAAAAGGG + Intergenic
1081256519 11:40903540-40903562 AATTTTAGAACCTTTTGAAAAGG + Intronic
1081330780 11:41797121-41797143 ACTGTTTTAAACTTTTGAACTGG + Intergenic
1082056100 11:47817686-47817708 ACTGTTTTAACCTTTTTATTAGG - Intronic
1084992587 11:72941752-72941774 ACTGATATAATCTTTTCAGAGGG + Intronic
1086198138 11:84166584-84166606 ACTGGTATATTCGTTTGAAAAGG - Intronic
1086751366 11:90498125-90498147 ATTGTTATAACTTTTTGAAGTGG + Intergenic
1088306757 11:108418583-108418605 ATTTTTCTAACTTTTTGAAATGG - Intronic
1088678426 11:112218842-112218864 ATTGATACAACCTTTTGAAGAGG + Exonic
1090022347 11:123138954-123138976 ACTCTTCTAACATTTTTAAATGG + Intronic
1090091651 11:123703360-123703382 GCTGTTGGAACATTTTGAAAAGG + Intergenic
1090789609 11:130080214-130080236 ACTATTATAATTTTTTGAGACGG + Intronic
1090975352 11:131675423-131675445 ATTGTTATAACTTTTTGGAATGG + Intronic
1092271005 12:7023312-7023334 ACTGGTAGAGTCTTTTGAAAGGG - Intronic
1093480798 12:19601923-19601945 ACTGTTTTTCCCTTTTGGAATGG + Intronic
1094005398 12:25743954-25743976 ACAGTTATAAGCTTTTATAATGG - Intergenic
1094168348 12:27465208-27465230 ATTCTTACCACCTTTTGAAAAGG - Intergenic
1095193640 12:39287131-39287153 ACTGTTTTAACCTTAGGCAATGG + Intergenic
1095601468 12:44017709-44017731 AATGTTATAATATTTTGAAGTGG - Intronic
1097132256 12:56820797-56820819 ACTGTTATCTTATTTTGAAATGG + Intergenic
1098561975 12:71884750-71884772 ACTGTCAGTACCTTTTAAAAAGG + Intronic
1098655371 12:73022401-73022423 ACTTTTATAATCTTTTGATTTGG + Intergenic
1099549035 12:84020100-84020122 ACTATTACAAACATTTGAAATGG + Intergenic
1100190967 12:92191167-92191189 ACTCTTTCAAACTTTTGAAAAGG - Intergenic
1100742645 12:97611090-97611112 ACTGTTTTAATCTTTTAAAAAGG + Intergenic
1103276438 12:119715712-119715734 ACTGTTAAAACCATTAGAACAGG + Intronic
1105256576 13:18747237-18747259 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1105256998 13:18750324-18750346 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1105258314 13:18759857-18759879 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1105259679 13:18769699-18769721 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1105260971 13:18779157-18779179 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1105263279 13:18795748-18795770 ACTTTTCAAAACTTTTGAAAAGG - Intergenic
1106564760 13:30874549-30874571 GCTTTTATCATCTTTTGAAAAGG - Intergenic
1106612970 13:31301078-31301100 ACTGTCATAATCTTTGCAAAGGG + Intronic
1106705817 13:32278325-32278347 GCTGTAATGACTTTTTGAAAAGG - Intronic
1106929551 13:34649148-34649170 ACTGTTGCAACCTATTGAAGTGG - Intergenic
1107900349 13:45006406-45006428 ATTTATATAACATTTTGAAATGG + Intronic
1107949103 13:45445981-45446003 ACTGTTATAATTTTTGCAAAGGG + Intergenic
1109470147 13:62793195-62793217 ACTGTAATAATCTTTCCAAAGGG - Intergenic
1110191660 13:72736743-72736765 ACTGGTATAACCTTTTAGGAGGG - Intronic
1110540717 13:76703715-76703737 ACTGACAGAAGCTTTTGAAAAGG + Intergenic
1112371925 13:98801917-98801939 ACTGATAAAACATTGTGAAAAGG - Intronic
1112382760 13:98908287-98908309 ATTGTTATAGCCTTTTGGGACGG + Intronic
1112623217 13:101073795-101073817 AAAGGTATAACCTTTGGAAAAGG - Intronic
1114434889 14:22697841-22697863 ACTATTATTATCTTTTGAGACGG - Intergenic
1114602420 14:23967444-23967466 TCTGTGTTTACCTTTTGAAAGGG - Intronic
1114608639 14:24019932-24019954 ACTGATATAGCCTATTTAAATGG - Intergenic
1114725725 14:24934501-24934523 ACTCTCATCACCTCTTGAAAAGG + Intronic
1114863173 14:26553053-26553075 AATGATATAACCTGTTTAAAAGG + Intronic
1115825866 14:37274017-37274039 ACTGTTAATAGATTTTGAAAGGG + Intronic
1115857472 14:37646224-37646246 CCAGTTATAGACTTTTGAAATGG + Intronic
1115873844 14:37838340-37838362 ACTTTTATAGCATTTTGACATGG - Intronic
1116163962 14:41310281-41310303 AATGTTATAATCTTTATAAATGG - Intergenic
1116558014 14:46337797-46337819 AATGTACTGACCTTTTGAAAAGG - Intergenic
1117536596 14:56708455-56708477 AGTGTTAACATCTTTTGAAATGG - Intronic
1118234237 14:63986374-63986396 ACAGGTGTAACTTTTTGAAAAGG + Intronic
1118266764 14:64302110-64302132 ACTCTTATGACCCTGTGAAATGG - Intronic
1118507662 14:66431525-66431547 ACTGTTACAACATTTTGAGTGGG + Intergenic
1119565182 14:75622821-75622843 ACTCTTATAATTTTTTTAAAAGG - Intronic
1119571106 14:75673394-75673416 AGTGTTATAACCTTTGAAGATGG - Intronic
1120094673 14:80375164-80375186 ACTGTTATAAACTTTGGAAAAGG - Intronic
1120145421 14:80973476-80973498 ACTCTTAAAACCTTTCGACACGG - Intronic
1121872500 14:97421401-97421423 AATGTTTTAACATTTTTAAAGGG - Intergenic
1202835073 14_GL000009v2_random:71946-71968 ACTTTTTGAAACTTTTGAAAAGG + Intergenic
1202835455 14_GL000009v2_random:74866-74888 ACTTTTGGAAACTTTTGAAAAGG + Intergenic
1125295398 15:38197520-38197542 TCTGTTATAAAATTTTTAAAAGG - Intergenic
1125342482 15:38688567-38688589 ACTGTTATAATTTTTTGCAAAGG - Intergenic
1125914698 15:43475365-43475387 ACTATTATAAAATTTTCAAATGG + Intronic
1126000271 15:44203064-44203086 ACTTTTATAACATGTTGAACAGG - Intergenic
1126200947 15:45985503-45985525 AATGTGATATCATTTTGAAAGGG + Intergenic
1126477991 15:49087423-49087445 TCTTTTATTTCCTTTTGAAATGG + Intergenic
1127687362 15:61361661-61361683 ACTATTATAAACAATTGAAAAGG - Intergenic
1128170302 15:65505499-65505521 ACTGTTTTAAACTTTTATAATGG - Intronic
1128764843 15:70244811-70244833 ACTTATATATTCTTTTGAAACGG - Intergenic
1129361114 15:75024928-75024950 ACTATTATTATATTTTGAAATGG + Intronic
1129488533 15:75901765-75901787 TCTTTTAAAACCTCTTGAAATGG - Intergenic
1130454166 15:84088505-84088527 ACTTTTTTTTCCTTTTGAAATGG + Intergenic
1131731213 15:95283419-95283441 TCTCTCATAACCTTTTGAACTGG - Intergenic
1135542410 16:23341802-23341824 GCTGTAATAACTTTTTAAAATGG + Intronic
1136676944 16:31919079-31919101 ACCTATATAACCATTTGAAATGG - Intergenic
1137659708 16:50193996-50194018 ACTGTTGGTAACTTTTGAAAGGG + Intronic
1137859242 16:51829900-51829922 ACTAAAATAACCTATTGAAAAGG + Intergenic
1138203804 16:55109551-55109573 ATTTTTATAAGCTTTTGGAAGGG - Intergenic
1139522758 16:67494290-67494312 ACTATTTTAACCATTTTAAAGGG - Intergenic
1139725560 16:68894744-68894766 ACCATTTTAACCATTTGAAATGG + Intronic
1141075508 16:81003409-81003431 AATGCAATAACCTTATGAAACGG + Intronic
1143208637 17:5166152-5166174 ACTGTCATCATCTTTTGAACTGG - Intronic
1144617964 17:16794263-16794285 ACTGTCATCATCTTTTGAACTGG - Intronic
1144894741 17:18521420-18521442 ACTGTCATCATCTTTTGAACTGG + Intergenic
1145137481 17:20422811-20422833 ACTGTCATCATCTTTTGAACTGG - Intergenic
1146985977 17:37218355-37218377 ATTGTTATTACATATTGAAATGG + Intronic
1147505306 17:41010513-41010535 ACTGGTAAAACCTTTAGAAATGG + Intronic
1149708295 17:58715807-58715829 ACTGTTTTAAACTTTTGACCTGG + Intronic
1149871646 17:60187413-60187435 ACTGTCATCATCTTTTGAACTGG + Intronic
1150965458 17:69962978-69963000 ACTGTTATAAAATTCTGAATAGG - Intergenic
1151241932 17:72764886-72764908 ACTGTTATAATTTTTTGCAAAGG - Intronic
1153739162 18:8105032-8105054 AGTTTTCAAACCTTTTGAAAAGG + Intronic
1154180335 18:12132477-12132499 ACTGTAATCACTTTTTAAAAGGG - Intergenic
1154425048 18:14265647-14265669 ACTTTTGGAAACTTTTGAAAAGG + Intergenic
1154434468 18:14333442-14333464 ACTTTTGGAAACTTTTGAAAAGG + Intergenic
1155511980 18:26587520-26587542 GCTGTTATCACGTTATGAAATGG - Intronic
1156929342 18:42622406-42622428 TCTGTTGCAACTTTTTGAAAAGG - Intergenic
1156953446 18:42933391-42933413 ACATTTGTAACCTTGTGAAATGG + Intronic
1157024276 18:43824224-43824246 GGAGTTATAACCTTTTGGAATGG - Intergenic
1157762937 18:50277256-50277278 ACTCATACAACCTTTTGACAGGG + Intronic
1158387894 18:57015477-57015499 ACTTTTAAACTCTTTTGAAATGG + Intronic
1159063809 18:63545730-63545752 AATGGTATACCCTTTTGGAAAGG + Intergenic
1159496988 18:69219563-69219585 ACTGTTAAAAGCTTTTGTCAGGG + Intergenic
1162120709 19:8465569-8465591 ACTTTTATAACATATTGACAAGG - Intronic
1165005049 19:32797900-32797922 ACTTTTATAGCCGCTTGAAAAGG - Intronic
1165604428 19:37088454-37088476 AATACTATAACTTTTTGAAATGG - Intronic
1202637173 1_KI270706v1_random:52483-52505 ACTTTTAGAAACTTTTGAAAAGG - Intergenic
1202637553 1_KI270706v1_random:55402-55424 ACTTTTTGAAACTTTTGAAAAGG - Intergenic
925061540 2:894638-894660 AATGTTATTACCAATTGAAATGG + Intergenic
925774783 2:7324365-7324387 AGTGGTATAAGCTTATGAAAAGG + Intergenic
926057640 2:9784354-9784376 ACAGCTATAGCCTTATGAAAAGG - Intergenic
926328688 2:11807229-11807251 ACTGGGATAACCTTTTGAGAGGG - Intronic
926886311 2:17602051-17602073 ACTCTTCTAACATTTTGAAATGG + Intronic
927010078 2:18894388-18894410 ACTTTTATAGCCTTTTAAAGAGG - Intergenic
927636106 2:24818447-24818469 CCTGTTTGAAACTTTTGAAAAGG + Intronic
928704098 2:33929020-33929042 ACTATTAGGACATTTTGAAAAGG + Intergenic
928787731 2:34910091-34910113 ACTATTAGAATCTTTTAAAAAGG - Intergenic
931415092 2:62073162-62073184 ACAGTGCTAACCTATTGAAATGG + Intronic
931504271 2:62906892-62906914 AATCATATAACCTTTTGGAATGG + Intronic
932018828 2:68061793-68061815 ACTGCTTTTACCTTTTCAAATGG - Intronic
932538363 2:72623747-72623769 ACTTTTTGAACCTTTTGAATAGG - Intronic
932596315 2:73095856-73095878 ATTGTGCCAACCTTTTGAAAGGG - Intronic
934114261 2:88769361-88769383 ACTGTCATAAGTTTTTGAAATGG - Intergenic
934220734 2:90080109-90080131 CCTGTTATAACAGTTTGAAATGG - Intergenic
934492059 2:94768157-94768179 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
934635764 2:95988326-95988348 ACTGTCATAAGTTTCTGAAATGG + Intronic
934835532 2:97586331-97586353 ACTGTCATAAGTTTTTGAAATGG + Intronic
935695167 2:105765115-105765137 ACTGGCATAACCCTTTGTAAGGG - Intronic
936089559 2:109492233-109492255 AATGTTGTCACATTTTGAAATGG - Intronic
938316117 2:130329585-130329607 ATGGTTATAACATTTTAAAATGG - Intergenic
938582463 2:132659204-132659226 TCTGCTATAATATTTTGAAATGG + Intronic
938819396 2:134939815-134939837 AAAGATATAACCTTTAGAAAAGG - Intronic
938961307 2:136343931-136343953 ACCACTATAACATTTTGAAAAGG + Intergenic
939830073 2:147061222-147061244 TCTTTCATAACCTTTTTAAAAGG - Intergenic
940435773 2:153652251-153652273 ACTTTTACAACCTTTAGAATAGG - Intergenic
940549669 2:155138142-155138164 ACTGTCATAATTTTTGGAAAAGG + Intergenic
941708270 2:168683206-168683228 ACTGGAATAACCTTTCTAAAGGG - Intronic
943252540 2:185547071-185547093 ACTGACATAAACTTTTGCAAGGG - Intergenic
944181514 2:196900460-196900482 ACTGTTAATAACTTTTTAAAGGG + Intronic
944613776 2:201439190-201439212 ACTGTTAGAACATGTGGAAATGG + Intronic
945237319 2:207643360-207643382 ATTGTTATAAACGTTTGAGAAGG + Intergenic
945332670 2:208557877-208557899 ACTGTTATAATTTTTTGCAAAGG + Intronic
947957709 2:234208211-234208233 ATTGTCAACACCTTTTGAAATGG + Intergenic
948638379 2:239356216-239356238 ACTGTTTTCACCTTTTTAAAAGG - Intronic
1171188595 20:23141900-23141922 CCTGTTAAAACCCTTTGAGACGG + Intergenic
1172297628 20:33824511-33824533 ACTGTTATTACATTCTGGAATGG + Intronic
1173343594 20:42177721-42177743 ACTGTTATAACCATTTTATGGGG + Intronic
1175679527 20:60975873-60975895 ACTTCAATTACCTTTTGAAAAGG - Intergenic
1176842570 21:13852265-13852287 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1176844306 21:13864874-13864896 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1176845682 21:13874721-13874743 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1176848415 21:13894276-13894298 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1176918533 21:14657067-14657089 GCTGTTATAACCTTTGAAAAAGG - Intronic
1177291644 21:19120595-19120617 ACTGTAATAATTTTTTTAAACGG + Intergenic
1178267448 21:31156897-31156919 ACTGTTGGAAGCTTTAGAAAAGG - Intronic
1178544491 21:33481335-33481357 TCTTTAAGAACCTTTTGAAAGGG + Intergenic
1180566297 22:16669052-16669074 ACTGTAATCACTTTTTAAAAGGG + Intergenic
1180651076 22:17377663-17377685 GCTATTATAACCTTTTCAGATGG + Intronic
1181919012 22:26305382-26305404 ACTGTTATGACCTTTCGGGAGGG - Intronic
1182143100 22:27979558-27979580 ACTTATATAACCCTTTAAAAAGG + Exonic
949285122 3:2393818-2393840 ACTGAGATAACCTTTAGACAGGG + Intronic
950285596 3:11742305-11742327 ACTCATATAACATTTTGAAATGG - Intergenic
950324319 3:12091462-12091484 ATTATTATAGCCTTTTTAAAAGG + Intronic
951465371 3:22995585-22995607 ATTTGTATAATCTTTTGAAAAGG + Intergenic
952528128 3:34234493-34234515 TCTCTTATAACCTTCTGAATGGG - Intergenic
952630697 3:35462527-35462549 TCTGTTATAACCTGTTAAGAAGG - Intergenic
955512903 3:59699120-59699142 AATGTTATATTCTTCTGAAATGG + Intergenic
956638670 3:71393709-71393731 TCTGAGATAATCTTTTGAAAGGG + Intronic
957174946 3:76795783-76795805 ACTTTGAAAACCTTCTGAAAAGG - Intronic
958114530 3:89198290-89198312 ACAGTTACAACCATTTTAAATGG + Intronic
960627792 3:119698461-119698483 TCAGTTATAATCTTTTGCAAAGG + Intergenic
962376849 3:134865845-134865867 ACCGTTTTAACCTTTAAAAATGG - Intronic
964597294 3:158448894-158448916 ACTGTTATAAAGTTTACAAAAGG + Intronic
964677927 3:159304362-159304384 ACGGATATAACCTTCTGTAATGG - Intronic
964692925 3:159473100-159473122 ACTGTTATAACTGTTTCATATGG - Intronic
964904324 3:161700130-161700152 ACTGTCACAAACTTTTAAAAAGG - Intergenic
967512320 3:190325963-190325985 ACTGACACAACCTTTTAAAATGG + Intronic
968245347 3:197140691-197140713 ACTGTTTTAGCCTTTAAAAAAGG + Intronic
970183406 4:13423226-13423248 ACAGTTGTAACCTTTAAAAAAGG + Intronic
970189969 4:13505780-13505802 ACTTTTTTAAACTTTTGAGATGG - Intergenic
970334252 4:15017689-15017711 ACTGTCATAGGGTTTTGAAAGGG + Intronic
970995015 4:22257054-22257076 ACTGTTACAAAATATTGAAAAGG - Intergenic
971068315 4:23060340-23060362 CCTGAAATAACCTTTTAAAAGGG + Intergenic
971272691 4:25165539-25165561 CCTGTCAGAACATTTTGAAAGGG + Intronic
972556627 4:40188378-40188400 ACTGTTATCTCCATTTGCAAAGG - Intergenic
973367796 4:49221766-49221788 ACTTTTTGAAACTTTTGAAAAGG - Intergenic
973393259 4:49573662-49573684 ACTTTTTGAAACTTTTGAAAAGG + Intergenic
973393635 4:49576582-49576604 ACTTTTGGAAACTTTTGAAAAGG + Intergenic
974071878 4:57131283-57131305 CCTCTCATAACCTTTGGAAAGGG + Intergenic
974765804 4:66344243-66344265 TCTGTTATTTCCATTTGAAATGG - Intergenic
976756016 4:88498511-88498533 TCTGTTATTCCCTTTTGAAATGG + Intronic
977196204 4:94063421-94063443 ATTATTCTATCCTTTTGAAAAGG - Intergenic
977267674 4:94875313-94875335 ACTGTTTTAACAGTTTGAACTGG + Intronic
978512624 4:109537309-109537331 ACTTATATAACCTTTTTAGAGGG + Intronic
978943866 4:114471087-114471109 ACTGTTATCACCTTTAACAATGG - Intergenic
979499325 4:121420969-121420991 ACTGTTAAAAGAATTTGAAAAGG - Intergenic
979722685 4:123920351-123920373 ATTGTTTTAATCTTTGGAAAGGG - Intergenic
979844624 4:125491608-125491630 ACTGGGACAACCTTTTGAACTGG + Exonic
980190599 4:129519833-129519855 ACCATTAAAACCTTTTAAAAAGG - Intergenic
980572144 4:134633971-134633993 ACTAAAATAACCTTTTAAAATGG - Intergenic
980656133 4:135789182-135789204 AGTGTCATAAACTTTTGAAATGG + Intergenic
981457641 4:144973101-144973123 ATTTTTCTAACATTTTGAAATGG - Intronic
981603168 4:146514902-146514924 AATGTTGTATTCTTTTGAAAAGG + Intronic
984169804 4:176345843-176345865 CCTGTTGTAACCTTTTGCAGGGG - Intergenic
984638108 4:182135609-182135631 ACCGTTACACCCATTTGAAATGG - Intergenic
984670793 4:182484692-182484714 ACTTTTAATACATTTTGAAATGG - Intronic
984709207 4:182870794-182870816 ATTTTTATAACCTTTTGGAAAGG + Intergenic
1202764492 4_GL000008v2_random:138340-138362 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1202764870 4_GL000008v2_random:141257-141279 ACTTTTTGAAACTTTTGAAAAGG - Intergenic
987687355 5:21222011-21222033 AGTGTTATTACAATTTGAAAAGG - Intergenic
987741247 5:21911863-21911885 AATGTTATAAACTTTTTAATGGG - Intronic
988018214 5:25588542-25588564 ATTCTTCTAACTTTTTGAAATGG - Intergenic
988238146 5:28573706-28573728 ACTTTTATAAAATTTTGAATAGG - Intergenic
988372346 5:30387977-30387999 ACTGATATAATTTTTTGCAAAGG - Intergenic
989291630 5:39773312-39773334 ACTTTTATAACAATTTGACAAGG - Intergenic
989369838 5:40694999-40695021 TCTGTTATATCCTTTTGAGATGG - Intergenic
989798676 5:45507579-45507601 ACTGTTATTTCTCTTTGAAAAGG - Intronic
991011522 5:61887857-61887879 TCTGTAACAACCTTTTGACAGGG - Intergenic
992714070 5:79492059-79492081 ACTTTTTTAACCTTGGGAAAGGG - Intronic
993130655 5:83894067-83894089 GCTGTTATAAAATTTTTAAAAGG - Intergenic
993596676 5:89864964-89864986 ATTGTTATATCTTTTTCAAAAGG - Intergenic
993833627 5:92789414-92789436 GCTGTTTTTCCCTTTTGAAATGG + Intergenic
993909954 5:93669264-93669286 AGTTTTATCACCTTTTAAAAAGG - Intronic
994823776 5:104686247-104686269 ACTGTTCTTTACTTTTGAAATGG + Intergenic
995105040 5:108367556-108367578 AGTTTAATAACTTTTTGAAAAGG + Intronic
996024509 5:118629730-118629752 ACTGTTTTAAATTCTTGAAAAGG + Intergenic
996262969 5:121496677-121496699 ACTTTTATTACCTTTTCAATTGG + Intergenic
996640800 5:125750821-125750843 AATTTTATAACATTGTGAAATGG + Intergenic
997154272 5:131536267-131536289 ATTGTTATGATCCTTTGAAAGGG - Intronic
998900327 5:146846372-146846394 ACTATTATTATTTTTTGAAATGG - Intronic
999845233 5:155472029-155472051 ACTGTCATATCCTTAGGAAATGG + Intergenic
1000076204 5:157789545-157789567 ACTGTGCTAACATTTTGCAAAGG + Exonic
1001424424 5:171614220-171614242 CCTGCTACAACCTTGTGAAATGG + Intergenic
1002716186 5:181229561-181229583 ACAGTTACAACCTTTGGAAGAGG + Intronic
1004091807 6:12510693-12510715 ACTGTTATAACCATTATCAAAGG + Intergenic
1004709020 6:18152814-18152836 AGTGGTAGAATCTTTTGAAAGGG - Intronic
1005224771 6:23629407-23629429 AATGCTTTAACTTTTTGAAAAGG + Intergenic
1005699051 6:28381699-28381721 AGTGTTATTGCCTTTTGATATGG - Exonic
1005725720 6:28646258-28646280 ACTCTTAAAACATTTGGAAAAGG + Intergenic
1007021289 6:38524281-38524303 ACTGTTCTATCATTTGGAAATGG - Intronic
1007023755 6:38548778-38548800 ACTGTTGTAACCTGATAAAAGGG + Intronic
1008239592 6:49093267-49093289 ACTGTAATAATTTTTTCAAAGGG - Intergenic
1009701480 6:67188152-67188174 AATTTTATAACATTTTGAAAAGG + Intergenic
1009925274 6:70113244-70113266 ACTGTTATTATCTTTTGTAGGGG + Intronic
1011423991 6:87205483-87205505 AATGTTCTAACATTTTAAAATGG - Intronic
1012297235 6:97540216-97540238 ACTGTTAAACACTTTTTAAAAGG - Intergenic
1012301987 6:97601259-97601281 AAGGTTATAACCTTCTGATAGGG + Intergenic
1012746507 6:103096909-103096931 AGTTTTAAAACCTTTTAAAAAGG + Intergenic
1014312515 6:119822011-119822033 GCTTTTATAACCTCTTGTAAAGG - Intergenic
1014654152 6:124078425-124078447 ACTCTTATAACCCTTTGAGATGG + Intronic
1015151259 6:130041075-130041097 ACTTTTTGGACCTTTTGAAAGGG + Intronic
1015744920 6:136499407-136499429 ACTGTTATCACCATTTTACAGGG + Intronic
1016637395 6:146309416-146309438 ACATTTTTAAGCTTTTGAAAAGG + Intronic
1017364526 6:153619348-153619370 ACTTTTCTAACCATTTGAAAGGG - Intergenic
1017684911 6:156902909-156902931 AAAGTTATAACCTTTTTCAAGGG + Intronic
1017928777 6:158934267-158934289 ACTGTTATATCCTTTTGATCAGG - Intergenic
1018282524 6:162202939-162202961 ATTTTTATAACCTTTTGTAAAGG + Intronic
1019829836 7:3316867-3316889 ACTATTTAAACCTTTTAAAAAGG + Intronic
1023396461 7:39756199-39756221 AATGTTATAACCTTATGGAGGGG + Intergenic
1027884292 7:83883736-83883758 TCAGTTATAACCTTATGACATGG + Intergenic
1028663403 7:93311286-93311308 ACTGTTATAATTTTTTTTAAAGG - Intronic
1029011433 7:97265743-97265765 AGTGTTATAGCCTTTTGGAAAGG + Intergenic
1030070125 7:105690992-105691014 ACATTTATAACATTTTTAAAAGG - Intronic
1033168465 7:139062548-139062570 ACTGTTACCACTTTCTGAAATGG + Intronic
1034011871 7:147537176-147537198 ACAGTTATAACCTTTCTAATAGG + Intronic
1035867167 8:3097368-3097390 TCTGTAATACTCTTTTGAAATGG - Intronic
1037428763 8:18786941-18786963 ACTTTTATTCCCTTTGGAAATGG - Intronic
1037629551 8:20641503-20641525 ATTGTTATATCCTTAGGAAAGGG + Intergenic
1038160314 8:25030993-25031015 ACTGTCATAATCTTTGCAAAAGG + Intergenic
1038405473 8:27319339-27319361 CCTGTTGTAACTTTTTAAAACGG - Intronic
1038765553 8:30424398-30424420 ATTGTTATAATTATTTGAAAGGG + Intronic
1040082044 8:43295537-43295559 ACTGTTATAAATTTTCAAAAAGG - Intergenic
1040351991 8:46578448-46578470 GCTCTTAAAAACTTTTGAAAAGG - Intergenic
1041893042 8:62892968-62892990 ACTGATATACACTTTTGAGATGG - Intronic
1042831329 8:73032140-73032162 ACTGTTATAACAGTTTTAGAAGG + Intronic
1043503436 8:80878545-80878567 ACTTTCATAAGCTTTTTAAAGGG - Intergenic
1045983623 8:108221373-108221395 AAAATTATAACCTTTAGAAATGG - Intronic
1046860116 8:119081808-119081830 ACTGTTGAAACATTTTGAATTGG + Intronic
1047043358 8:121023676-121023698 ACTGGAATATCCCTTTGAAAGGG - Intergenic
1047055730 8:121162834-121162856 ATTGTTATAACCTAATGTAAAGG - Intergenic
1048748166 8:137639066-137639088 ACTGTTATAAACTTATAGAAGGG + Intergenic
1049404302 8:142444836-142444858 ACTGTTAGAACCTTGTTAACAGG + Intergenic
1049733915 8:144193208-144193230 ACTGTTAAAACTGTATGAAATGG + Intronic
1049933662 9:479989-480011 CCTGTTATAACCTGCTGAGAAGG - Intronic
1050648298 9:7746176-7746198 TCTGTTTTTCCCTTTTGAAATGG + Intergenic
1051454349 9:17237123-17237145 AATCTTATACCCTTTTTAAAAGG + Intronic
1054991733 9:71335665-71335687 ACAGAAATAACCTTTTTAAAAGG + Intronic
1055824666 9:80308944-80308966 ACTGTAATGACCTTTCCAAAAGG + Intergenic
1056094307 9:83235729-83235751 ACTGTTAGGAGCTCTTGAAATGG + Intergenic
1056422708 9:86445155-86445177 ACTTATATAACATTTTTAAATGG + Intergenic
1057503466 9:95614257-95614279 TCTGTTATAACCTGATTAAAAGG + Intergenic
1057675749 9:97134771-97134793 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1057676629 9:97140956-97140978 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1058813850 9:108665952-108665974 ACTATTATAACCATTTCACAAGG - Intergenic
1059099062 9:111452099-111452121 ACTGTGATAAACTTTAGACAAGG + Intronic
1059870439 9:118567838-118567860 AAGGTTATAAACTTTTCAAAAGG - Intergenic
1203545240 Un_KI270743v1:123227-123249 ACTTTTGGAAACTTTTGAAAAGG - Intergenic
1203545620 Un_KI270743v1:126145-126167 ACTTTTTGAAACTTTTGAAAAGG - Intergenic
1186443591 X:9606921-9606943 ACTGTTTTGTTCTTTTGAAAGGG - Intronic
1186720048 X:12294273-12294295 ACTGTCATTAGCTTTTCAAAAGG - Intronic
1186896254 X:14007356-14007378 ACTGTAATAACTTATTTAAAAGG + Intergenic
1187354759 X:18557489-18557511 ACTGTTATAACCTTTTGAAATGG + Intronic
1187980517 X:24752000-24752022 AATTTTATAATCTTTTGCAATGG - Intronic
1189704438 X:43745784-43745806 ACAGTTGAAACCTTTGGAAAGGG - Exonic
1190491432 X:50986581-50986603 ACTGTTGAAAACTTTTGCAAAGG + Intergenic
1190856647 X:54302008-54302030 AGTTTAATAACCTTTTGACAAGG + Intronic
1192110440 X:68358314-68358336 ATTATTATTACTTTTTGAAATGG - Intronic
1193487038 X:82098412-82098434 ACTGTTATAAAATTTAGTAATGG - Intergenic
1193499015 X:82249926-82249948 ACTGCTATAAACTTTTGTATAGG + Intergenic
1194072359 X:89341571-89341593 TTTGGTATAACCTTTGGAAATGG + Intergenic
1195328213 X:103775239-103775261 ACTATTATACCGTTTTGCAAGGG + Intronic
1196941399 X:120779741-120779763 ACTGTTATCACCATTTGCAGAGG - Intergenic
1198579986 X:138052598-138052620 GCTGTTAAAACTTTTTCAAAAGG - Intergenic
1200726601 Y:6677317-6677339 TTTGGTATAACCTTTGGAAATGG + Intergenic
1200727753 Y:6693093-6693115 TTTGGTATAACCTTTGGAAATGG + Intergenic
1201342140 Y:12945923-12945945 ACTAATATAATTTTTTGAAAAGG + Intergenic