ID: 1187356544

View in Genome Browser
Species Human (GRCh38)
Location X:18578387-18578409
Sequence TGATAGGTATACAACTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187356544 Original CRISPR TGATAGGTATACAACTTGAC TGG Intronic
900873921 1:5327654-5327676 TAATATGTATACAACATGACAGG - Intergenic
905934085 1:41810026-41810048 AGTCAGGTATAAAACTTGACTGG - Intronic
906966415 1:50461408-50461430 TGACAGGTATACACTTTGAAGGG - Intronic
906972811 1:50534681-50534703 TGATTGATATACAACTTCACGGG + Intronic
909714225 1:78688162-78688184 GAATATGTATAAAACTTGACTGG + Intergenic
1064583380 10:16816272-16816294 TGATAGGTGTCCCACTTGAAGGG - Intronic
1073865571 10:107800562-107800584 TGGTAGTTATACAGGTTGACTGG + Intergenic
1074136772 10:110634359-110634381 TTAGAGGAATACAAATTGACAGG + Intergenic
1074492387 10:113950463-113950485 TGATAGATAGACAAGTAGACAGG + Intergenic
1074492389 10:113950494-113950516 TGATAGGTAGATAGCTAGACAGG + Intergenic
1076940894 10:133607520-133607542 TGGTAGATGTAAAACTTGACAGG - Intergenic
1078206908 11:9238096-9238118 TGATATGAATTCAACTTGAGTGG + Intronic
1079505035 11:21143806-21143828 TGATGGGTATTCATCTTGCCGGG - Intronic
1080259171 11:30327194-30327216 AAATAGGTATTCAACTTCACTGG + Intronic
1093115726 12:15208344-15208366 TGACAGGAATGCAACATGACCGG - Intronic
1098621178 12:72601194-72601216 TGATAGGTTTAAAACTTCAGTGG + Intronic
1105768148 13:23580642-23580664 TGAAAGGTATAGAACTGGAGGGG + Intronic
1110535079 13:76641940-76641962 TGGTAGGAAAACAACTTGAGAGG + Intergenic
1111813508 13:93121081-93121103 TGATAGATCTGCAACTTGAGGGG + Intergenic
1115813992 14:37142849-37142871 TGAGAGGTATCCAGCTAGACTGG - Intronic
1120282447 14:82456532-82456554 TGATAATTAAACAACCTGACAGG + Intergenic
1120582857 14:86275312-86275334 TACTAGATATACAACTTGAACGG + Intergenic
1125262732 15:37846329-37846351 TGGTAGGTTAGCAACTTGACAGG - Intergenic
1126664656 15:51065572-51065594 TGATGGTTATAAAACATGACAGG + Intronic
1129647443 15:77449515-77449537 TGATATGCATACAATTTAACTGG - Intronic
1137223075 16:46474621-46474643 TGATGGCTATACAACTTTCCTGG - Intergenic
1146410500 17:32579538-32579560 TTTAAGGTATACAATTTGACAGG + Intronic
1151435686 17:74095536-74095558 TGATAGATATCCAACTTAATCGG - Intergenic
1155112589 18:22731079-22731101 GGAAAAGTATACAACTTCACAGG + Intergenic
1156658555 18:39317851-39317873 TCAAAGGTATACATCCTGACAGG + Intergenic
1159084076 18:63767841-63767863 TGATAGGTATAGAACTATTCAGG + Intronic
930935225 2:56941030-56941052 TAATAGGTATACATATTTACGGG + Intergenic
933337451 2:80976230-80976252 TGATAAGTAAACAAATTGGCAGG + Intergenic
943622186 2:190161367-190161389 TAATAGGTATGCTACTTGATAGG - Intronic
945290963 2:208127070-208127092 TGATAAGTATAGTACCTGACAGG + Intergenic
945541893 2:211098225-211098247 TGATAAGTATACTACCTGATGGG + Intergenic
945858498 2:215094432-215094454 TGATAGGTGGACAACTTCAGTGG - Intronic
947258364 2:228191581-228191603 TGATAGTCATAAAACTTGAAGGG + Intergenic
1171032533 20:21690624-21690646 TGAAAGGTATACAGCTTCTCAGG + Intergenic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
951018023 3:17750829-17750851 TGATAGATATATAAATTGAATGG - Intronic
951048811 3:18071424-18071446 TGATAGGTATATAACCTTATTGG + Intronic
951594598 3:24303629-24303651 TGATAGTTATGCAACATTACTGG + Intronic
953987379 3:47454969-47454991 ACATAGGTATACAACTGGAAAGG + Intronic
962182550 3:133223814-133223836 TAAAAGCTATAAAACTTGACAGG + Intronic
965356457 3:167680200-167680222 TTGTAGGTATCCAACTTCACTGG - Intergenic
966093349 3:176167533-176167555 TGGTAAGTATTCAACTCGACTGG - Intergenic
966922803 3:184625087-184625109 TGAGAGGTATAGAAATTGAATGG + Intronic
971075360 4:23141747-23141769 TGATAGTTATACATCTGGAAGGG - Intergenic
972863269 4:43199014-43199036 TGATGGGGATACAACTTAAAAGG + Intergenic
973872495 4:55180310-55180332 TGGGAGGTATACAAGTTGAATGG + Intergenic
974806769 4:66890756-66890778 TGATGGGTATACCTTTTGACTGG - Intergenic
976683073 4:87778957-87778979 TGATAGGTATAAAAATTAAATGG - Intergenic
989267858 5:39498295-39498317 CCATAGTTATTCAACTTGACAGG + Intergenic
990319036 5:54611766-54611788 TGATGGGGAAGCAACTTGACTGG + Intergenic
990537621 5:56738434-56738456 TGACAAGTATTCAACCTGACTGG + Intergenic
995680289 5:114710063-114710085 TGATAGGTATAGAACTGGCTTGG - Intergenic
996017196 5:118552878-118552900 CCATAGGTTTGCAACTTGACAGG - Intergenic
997162729 5:131625920-131625942 TTATAGGTATACAGGTAGACTGG - Intronic
997575639 5:134974845-134974867 TGTTAGGTATAGGACTTGGCAGG + Intronic
1002034315 5:176454888-176454910 TGTCAGGAATACAACTTGACTGG - Intronic
1006647887 6:35527639-35527661 TTCAAGATATACAACTTGACTGG - Intergenic
1012152018 6:95765868-95765890 TCAAAGTTATGCAACTTGACAGG - Intergenic
1013825376 6:114204910-114204932 TGATAAGTACACAACATGCCTGG + Intronic
1014281366 6:119445666-119445688 TAATAGGGATCCAGCTTGACAGG + Intergenic
1016846972 6:148578198-148578220 TGATATGTATACAAATTCAGTGG - Intergenic
1018296492 6:162351394-162351416 TAAAAGGTATTCAATTTGACAGG - Intronic
1026526674 7:71159611-71159633 TGACAGGTATACAATTCAACTGG + Intronic
1027146395 7:75698113-75698135 TGATAGTTATAAAACTGGGCTGG - Intronic
1032006476 7:128305867-128305889 TGAGAGGAATAAAACTGGACAGG + Exonic
1035609464 8:950289-950311 TGATTGTGATACAATTTGACAGG + Intergenic
1042386304 8:68178855-68178877 TGATTGCAATACAACTTCACTGG - Intronic
1044277572 8:90320443-90320465 TGATTTATATACAACTTTACAGG + Intergenic
1046466915 8:114616908-114616930 TAATCGATATACAACTTGAGTGG + Intergenic
1051871437 9:21742160-21742182 TGAAAGGTATTCAATTTAACAGG + Intergenic
1052529116 9:29658168-29658190 TGATGGGAATACATCTTGATGGG - Intergenic
1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG + Intronic
1055608465 9:77996270-77996292 TGATAAGTTTAAAACTTGATGGG + Intronic
1058188388 9:101883480-101883502 TTATAGGTAAACAATTAGACAGG - Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188548082 X:31332295-31332317 TGATCTGGATAAAACTTGACTGG - Intronic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1188855016 X:35183670-35183692 TGATCTGTATTAAACTTGACAGG + Intergenic
1189131567 X:38503289-38503311 TGATAGGCAATCAACTTGATTGG - Intronic
1192972419 X:76247487-76247509 TGAAAGGTATCCAAATTGAAAGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201476131 Y:14383201-14383223 AGGTAGGTATACAAGTAGACAGG - Intergenic
1201476141 Y:14383434-14383456 AGGTAGGTATACAAGTAGACAGG - Intergenic
1201735754 Y:17259481-17259503 TGATAATTATACAACTTGCTTGG + Intergenic